Skip to main content

Table 3 PCR assays, including primers sequences, accession numbers, amplicon sizes and PCR efficiencies

From: Transcriptional responses to temperature and low oxygen stress in Atlantic salmon studied with next-generation sequencing technology

Gene Gene product Accession no. Forward primer Reverse primer Amplicon size (bp) PCR efficiency*
CuZn SOD CuZn superoxide dismutase BG936553 CCACGTCCATGCCTTTGG TCAGCTGCTGCAGTCACGTT 140 1.92/2.02
Mn SOD Mn superoxide dismutase DY718412 GTTTCTCTCCAGCCTGCTCTAAG CCGCTCTCCTTGTCGAAGC 209 1.85/1.88
CAT Catalase BG935638 GGGCAACTGGGACCTTACTG GCATGGCGTCCCTGATAAA 59 1.85/2.12
GPX1 Glutathione peroxidase 1 EH033571 TCTCCTGCCATAACGCTTGA GTGATGAGCCCATGGCCTTA 137 1.84/-
GR Glutathione reductase BG934480 CCAGTGATGGCTTTTTTGAACTT CCGGCCCCCACTATGAC 61 2.00/1.91
HSP70 Heat shock protein 70 BG933934 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT 121 -/1.90
HIF1A Hypoxia-inducible factor 1A DY708816 CCACCTCATGAAGACCCATCA TCTCCACCCACACAAAGCCT 101 2.20/2.26
IGFBP1A Insulin-like growth factor binding protein 1A KC122927 GGTCCCTGTCATGTGGAGTT TTCCAGAAGGACACACACCA 184 2.10/2.08
IGFBP1B Insulin-like growth factor binding protein 1B AY662657 GAGGACCAGGGACAAGAGAAAGT GCACCCTCATTTTTGGTGTCA 101 -/2.02
MTOR Mechanistic target of rapamycin (serine/threonine kinase) BT072258 CAGCCTGAGGCCCTGAATAA CTCCACTTGGGTTGGCACAT 114 1.97/1.95
CYP1A Cytochrome P450, family 1, subfamily A >contig00118 length = 2495 numreads = 57 ATC GGACGCAACGAGGTCTA TGACAGCGCTTGTGCTTCAT 128 1.97/2.02
NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75 kDa >contig00384 length = 2136 numreads = 57 TGCTGCAGGACATCGCTAAC TGGTTTGCACAGAGCTCAAGA 135 1.94/2.01
PSMC2 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 >contig01910 length = 1544 numreads = 106 ATCAGGGTCATCGGCTCAGA GCCCCTCCAATAGCGTCAAT 132 1.94/2.02
HSP90B Heat shock protein 90B >contig03769 length = 1183 numreads = 111 CCACCATGGGCTACATGATG CCTTCACCGCCTTGTCATTC 114 1.97/1.95
EEF1AB Eukaryotic translation elongation factor 1AB (refgen) AF321836 CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA 57 1.99/2.01
ACTB Beta-actin (refgen) BG933897 CCAAAGCCAACAGGGAGAA AGGGACAACACTGCCTGGAT 102 2.06/1.90
RPL13 Ribosomal protein L13 (refgen) NM_001141291 CCAATGTACAGCGCCTGAAA CGTGGCCATCTTGAGTTCCT 110 -/1.91
  1. *Temperature experiment/low O2 experiment.