Skip to main content

Table 1 Amplification primers

From: A high-throughput Sanger strategy for human mitochondrial genome sequencing

Amplicon number Amplicon size Primer name Primer sequence Source
1 2417 F402 ATCTTTTGGCGGTATGCACTTT New
R2818 GCCCCAACCGAAATTTTTAAT New
2 2381 F2480 AAATCTTACCCCGCCTGTTT New
R4860 GAAGAAGCAGGCCGGATGT New
3 2291 F4609 AAATAAACCCTCGTTCCACAGA New
R6899 CATATTGCTTCCGTGGAGTGTG New
4 2511 F6636 ATTCTTATCCTACCAGGCTTCG New
R9146 GCGACAGCGATTTCTAGGATAG New
5 2489 F8940 CCCCATACTAGTTATTATCGAAACC New
R11428 GGCTTCGACATGGGCTTT New
6 2759 F11319 CAAACTCCTGAGCCAACAACTT New
R14077 TTTGGGTTGAGGTGATGATG New
7 2208 F13835 CAGCCCTAGACCTCAACTACC New
R16042 CTGCTTCCCCATGAAAGAAC [19]
8 1198 F15971 TTAACTCCACCATTAGCACC [13]
R599 TTGAGGAGGTAAGCTACATA [13]
  1. Amplification primer sequences for the eight mtGenome amplicons. The primers for Amplicon 8, which covers the mtDNA CR, were adopted from [13]. The reverse primer for Amplicon 7 (R16042) was previously designed for use as a sequencing primer [19]. All primers except F2480 (Amplicon 2), R4860 (Amplicon 2), R9146 (Amplicon 4) and R14077 (Amplicon 6) are also used for sequencing (see TableĀ 2).