Skip to main content

Table 2 BCL11A and HBS1L-MYB multiplex PCR amplification primers

From: Genotyping of BCL11A and HBS1L-MYB SNPs associated with fetal haemoglobin levels: a SNaPshot minisequencing approach

SNP Multiplex PCR primers (5′-3′) mPCR Reaction Amplicon fragment length (bp) Concentration (μM)
  Forward Reverse    
BCL11A      
rs11886868, rs766432 CACACCATGGATGAATCCCAGAα,* TGGTGCTACCCTGAAAGACGGα,* B 441 0.1
rs4671393, rs7557939 CCTTGTTTACAGAGGGGCAACCα,* GCCTTGGGAAGAAAGACAGCATα,* B 649 0.4
rs6732518 TGGGTGACCCTCTGACTCCT* GCTTTAACGCACTACACCCCACα,* A 69 0.1
rs10189857 AGCCATGGTCCACCCACAGAα,* TTCCAGGTCCCCCAGAAGTAGC* B 411 0.1
rs6545816 GGTTGATGAGAAAATTACCGCATTAα,* AACGAGGGTGTTCAAAGTAACCA* A 103 0.3
rs7599488, rs1427407 CTGGCCGGGAGCATTTCAAα,* TTTAACCTTCTTAGCACCCACAAA* GCACAGCATGTGACATGATATTCb B 515 0.6
0.5
rs10184550 CCTGATCTCTGATTGTTGCTTTGA* TGTACCACCAGAAGTCCTGGAAAα,* A 120 0.4
rs7606173 ACACCCTGTGATCTTGTGGα,* GCCAACAGTGATAACCAGC* A 201 0.8
rs6706648 GAAGCTTCCCCTGTCTGCAα,* TGAGTGCGTATTTGTAAAGTTCC* A 333 0.6
HBS1L-MYB      
rs28384513 CCTTGAGCTACCTACGCCAG* CTTTCTCAGATTATCAGGAACCAAATTT* GCCCACTGTGTGCTTAATGAAAb A 66 0.4
0.5
rs7776054, rs9399137 ATATGCAATATTTGTAATTTGTGTTCTGCα,* TTAACTATATCTGTGCACAGAAATACAGα,* B 190 0.8
rs9389268, rs9402685 TGCAACCTCCGCTTCCAα,* TAGCTCACACCTGTAATCATGCα,* A 221 0.2
rs4895441, rs4895440 GGAAACCAGTTTAGAAAGCGTGG* TCTCTCTGGATCTCCCTGTCα,* B 122 0.3
rs6929404 GCAGTGAGATTTCTATTATTAGGCTCα,* CTGACTAAACTTCTAATCAAAGGCAT* B 136 0.3
rs9402686 GAGCAGAGAAGTTTAAAGTGTGTG* TGGACAAAACTGCCCTTTGTCα,* B 150 0.4
rs1320963 ATGGCTTGGTAAGGACTTAAGAG* CCTGAGAGTTCTTTTGGGATCTT* B 60 0.4
TTCAACTTTCCACTGAGTTTTCGb 0.5
rs6904897 ATCCAGGCTTGCCAAATATACCT* GACTTGCCTGTGCTGGAAATTα,* A 99 0.3
rs35959442 TGACCCAGAGCGTCCAAGα,* GTTACATCTGCAGCTGACACC* A 160 0.8
rs9376090 GATATGGCCAATACCATATGAAGCTAAα,* AGCTGGGCCTCATTTGTTC* B 81 0.2
rs9494142 AGGAAGTGTCTTTGGTCTCTCAGα,* TGAGACTCCATCTCAAAAAACAACA* A 143 0.4
rs11759553 TTGCCAGGCTGTCTTGCAα,* GTTCTGCAGGGTCCTTTGG* B 107 0.2
rs6934903 CCTTGGCCCACATCGCTα,* TAGAACCTGAAACAGTACTCCACA* A 130 0.2
  1. *Used as PCR-RFLP primers at final concentration of 0.2 μM as described in the text.
  2. αUsed also as sequencing primers at final concentration of 0.5 μM as described in the text.
  3. bUsed only as sequencing primers as described in the text.