Skip to main content

Table 1 Elicitor-responsiveness of known Arabidopsis miRNAs as determined by microarray analysis

From: Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors

Name Sequence Direction of miRNA expression Target gene Biological function
5 min 30 min 60 min 120 min
miR156a ugacagaagagagugagcac - - - -1,79 SPL10 TF (At1g27370) 1 Development
miR156h ugacagaagaaagagagcac -4,13 -2,74 1,41 - SPL2 ( At5g43270) 2
miR164a uggagaagcagggcacgugca - 1,16 - - CUC1/2 TF (At5g53950/At3g15170) 2 Development. Auxin signaling
miR164c uggagaagcagggcacgugcg - 9,5 - - NAC080 TF/NAC100 TF (At5g07680/At5g61430) 3
miR165a ucggaccaggcuucauccccc 1,31 - - - PHABULOSA TF/ PHAVOLUTA TF (At2g34710/At1g30490) 4 Development
miR166a ucggaccaggcuucauucccc -1,29 - - -
miR168 ucgcuuggugcaggucgggaa 2,88 7,57 2,32 2,1 Argonaute1 (AGO1) (At1g48410) 1 miRNA functioning. Abiotic stress
miR169d ugagccaaggaugacuugccg - - - -2,32 ATHAP2B (At3g05690) 5 Development. Auxin signaling
miR170 ugauugagccgugucaauauc - -1,76 - - SCL TF 6 Development
miR415 aacagagcagaaacagaacau - 5,25 - - questioned miRNA  
miR418 uaaugugaugaugaacugacc - - - 6,63 questioned miRNA  
miR823 uggguggugaucauauaagau - 10,66 - - Chromomethylase 3 (CMT3) (At1g69770) 2 Gene silencing
miR833a-5p uguuuguuguacucggucuagu 4,55 3,1 2,83 -1,28 F-box containing protein (At1g77650) 2  
miR842 ucauggucagauccgucaucc - - - 3,09 Jacalin lectin (At5g28520) 7  
miR862-5p uccaauaggucgagcaugugc - -1,73 - - Unknown  
  1. 1[47]2[17]; 3[27]; 4[29]; 5[2]; 6[13]; 7[48]. SPL, Squamose promoter binding protein-like; CUC1/2 TF, cup-shaped cotyledon1/2 transcription factor; NAC (NAM, ATAF and CUC) transcription factor; SCL, Scarecrow-like (GRAS TF). -, no change in expression.
  2. miRNAs whose expression varies in at least one time point of elicitor treatment are listed (for details on the entire set of miRNAs represented in the microarray, see Additional file 1: Table S1. The fold change (elicitor-treated vs non-treated plants) for each miRNA is shown. Three biological replicates and three technical replicates for each biological sample were analysed.