Skip to main content

Table 3 Primers used for cloning full length gene of four candidate genes

From: Mapping and analysis of a novel candidate Fusarium wilt resistance gene FOC1 in Brassica oleracea

Primers Sequences (5′-3′)
Bol037156 GGTGACACTTCCTTCCTCCA//GCTCCATCGCCATCAAAGTT
Bol037157 TCGATTTTCCTCACCACCGA//TAAGCATCCCACCTGAGCAA
Bol037158 CTCAGATTGCTCAGGTGGGA//ACACACCCACATTGCGTTAC
Bol037161 GAAACTGTGTCCCTGCCATG//TGTGGCAGAGTTACATGGGT