Skip to main content

Table 4 Primers used for cloning of re-Bol037156 and re-Bol0371578 in the R_bulk and S_bulk lines

From: Mapping and analysis of a novel candidate Fusarium wilt resistance gene FOC1 in Brassica oleracea

Primers Sequences (5′-3′)
re-Bol037156 (DNA) CCCCAGATTCACAGCATTCG//ATACGAGTGTGTCTTCGCCA
re-Bol037156 (cDNA) ATCTTCACCACTCCAGTCA//ACTTAACTGGAATGAGCTAACCA
re-Bol0371578 (DNA) TCGATTTTCCTCACCACCGA//ACCCAGCCCTAATGAAAGCT
re-Bol0371578 (cDNA) TGAGTTGGTCCACGTACTTGA//AGGAGAAAGGGAAAGACGCA