Skip to main content

Table 5 Primers used for two InDel loci analysis in 80 lines

From: Mapping and analysis of a novel candidate Fusarium wilt resistance gene FOC1 in Brassica oleracea

Primers Sequences (5′-3′)
1-bp insertion AATCACTCCTCAGCCATCTT//ATACCAGTTCCGAGAATCCT
10-bp deletion AAGGAGGAGTGGATGGAG//GCTCTGATGTGTTGAAATAC