Skip to main content

Table 2 Identification of novel miRNAs on the other arm of known pre-miRNAs

From: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensi s by high-throughput sequencing and degradome analysis

miR_name miR_seq Len Flower buds
of A line
Flower buds
of B line
bra-miR164a-p3 CACGTGCTCCACTCCTCCAAC 21 108 44
bra-miR167b-p3 GATCATGTTCGCAGTTTCACC 21 6,061 3,762
bra-miR171b-p5 AGATATTAGTGCGGTTCAATC 21 53 17
bra-miR171e-p5 TATTGGCCTGGTTCACTCAGA 21 200 1,049
bra-miR172a-p5 GCAGCACCATCAAGATTCACA 21 8 8
bra-miR824-p3 CCTTCTCATCGATGGTCTAGA 21 520 3,882
bra-miR1140-p5 TCCGATTGGCTTTAGGCTGTTG 22 709 1,068
bra-miR5718-p5 TGTTCTGGTTTGATTTTGAAC 21 1,686 1,258