Skip to main content

Table 3 Oligonucleotide primers used for qPCR designed against GenBank sequence available for microarray features

From: Gene duplication in an African cichlid adaptive radiation

GenBank Primer sequence Homology   Primer efficiency
Predicted length A. burtoni Test species
DY626766 F: TCGGTCTCCTTAACCGGATG No Hit 193 86 74
  R: CTGAGTTTGGCTGCCCGTAA     (P. similis)
DY627986 F: ACGAACACCCGAACGGAAAC Hox gene cluster 222 100 104
  R: GGTGCACGCACATGAACTGT     (M. estherae)
DY631898 F: CGTCCCAGTGAGGATGAGGA MHC class II antigen 161 82 82
  R: TGATGCTGATCGGTTGATGC     (R. “chilingali”)
DY632057 F: ATTACTGCGAGTGCCGTCCA Pituitary adenylate cyclase activating 150 91 78
  R: CTGCGCCCTGAAAGAACAGA polypeptide receptor 1A    (A. tweddlei)
  1. Primer Efficiency: percent is based on 4-fold template dilutions for A. burtoni and one heterologous test species indicated in parentheses.