Skip to main content

Table 4 Primers used in real-time quantitative PCR of Lilium lancifolium (RT-qPCR)

From: Transcriptome profiling of the cold response and signaling pathways in Lilium lancifolium

Unigene Id Gene name Annotation Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) Correlation between RNA-Seq and qRT-PCR(r2) GenBank accession numbers
Contig15860 LlAP2 Putative AP2/EREBP transcription factor CCGCCCTCTTCAATCTCATC TATCTGGCTCGGCTCCTAC 0.98 KJ489026
Contig18777 LlLEA LEA-like protein AAGATGTTCCTCCTCGTGTTG GATGTTGGTCCTCGCCTTC 0.99 KJ489024
Contig11020 LlCIS Peptidyl-prolyl cis-trans isomerase TTGTTCCTTCCACCGCATTA AAAGCCTTCATCCTCAAACTTAGAC 0.95 KJ467624
Contig9406 LlDREB1 DRE-binding protein AAATCCGCCTCCCCAAGAA AGTTGAGCCGAGCGAAGT 0.98 KJ467618
Contig1500 LlHOT Heat shock protein ATGATTGGGAGGAGCACTTG GAAGACACGGCGGACATAA 0.97 KJ467620
Contig13202 LlCOR12 Cold-regulated LTCOR12 CGGACACAACTTGACTCTTACC CTTGCTATGCCTCGCTGAC 0.94 KJ489025
Contig1641 LlMYBR MYBR domain class transcription factor TTCCTCAGTCCACGCTATCC GCCGTTGCCTAACTACTTGTC 0.98 KJ467623
Contig25399 LlNAC1 NAC domain protein GGTTTAGAGGGAGGTTGGAGAAG CGACGACACTGGCTCATCA 0.94 KJ467622
Contig22048 LlCDPK Calcium-dependent protein kinase GTCGTGCTCCAATTACCAGAAG CAAGAGGAACAACATCACCAGAC 0.94 KJ467621
Contig5309 LlGPAT GPAT TGCAAAGTGGAAATCCTAATGCGAG AGGATCTGCTTCCGTCTGATGGTTT 0.97 KJ467617
  LlTIP1 Reference gene CGAAGCCAGAAACGGAGAAGAAT GGGTAGGGTGGATTGGGAAGA