Skip to main content

Table 1 Primers used to perform qPCR of selected candidates

From: Reliable reference miRNAs for quantitative gene expression analysis of stress responses in Caenorhabditis elegans

All conditions
miRNA Sequence Forward primer Reverse primer
mir-2-5p UAUCACAGCCAGCUUUGAUGUGC TCACAGCCAGCTTTGATG GTCCAGTTTTTTTTTTTTTTTGCAC
mir-46-3p UGUCAUGGAGUCGCUCUCUUCA TGTCATGGAGTCGCTCTC GGTCCAGTTTTTTTTTTTTTTTGAAGA
mir-47-3p UGUCAUGGAGGCGCUCUCUUCA CATGGAGGCGCTCTC GGTCCAGTTTTTTTTTTTTTTTGAAGA
UV
mir-357-3p AAAUGCCAGUCGUUGCAGGAGU TGCCAGTCGTTGCAG GGTCCAGTTTTTTTTTTTTTTTACTC
miR-57-5p UACCCUGUAGAUCGAGCUGUGUGU AGTACCCGTATAAGTTTCTGCT GGTCCAGTTTTTTTTTTTTTTTCTC
miR-55-3p UACCCGUAUAAGUUUCUGCUGAG GCAGTATGACACTGAAGCGT GTCCAGTTTTTTTTTTTTTTTCGGT
Heat-stress
miRNA Sequence Forward primer Reverse primer
miR-64-5p UAUGACACUGAAGCGUUACCGAA GCAGTATGACACTGAAGCGT GTCCAGTTTTTTTTTTTTTTTCGGT
miR-86-5p UAAGUGAAUGCUUUGCCACAGUC AGTAAGTGAATGCTTTGCCA GTCCAGTTTTTTTTTTTTTTTGAC
miR-794-5p UGAGGUAAUCAUCGUUGUCACU CAGTGAGGTAATCATCGTTGT GTCCAGTTTTTTTTTTTTTTTAGTGA
Hypoxia N2 +hif-1
miRNA Sequence Forward primer Reverse primer
miR-230-3p GUAUUAGUUGUGCGACCAGGAGA GGTATTAGTTGTGCGACCAG GGTCCAGTTTTTTTTTTTTTTTCTC
miR-357-3p AAAUGCCAGUCGUUGCAGGAGU TGCCAGTCGTTGCAG GGTCCAGTTTTTTTTTTTTTTTACTC
miR-58-3p UGAGAUCGUUCAGUACGGCAAU CAGTGAGATCGTTCAGTACG GGTCCAGTTTTTTTTTTTTTTTATTGC
Hypoxia N2
miRNA Sequence Forward primer Reverse primer
miR-52-5p CACCCGUACAUAUGUUUCCGUGCU ACCCGTACATATGTTTCCGT GGTCCAGTTTTTTTTTTTTTTTAGCA
miR-254 UGCAAAUCUUUCGCGACUGUAGG GCAAATCTTTCGCGACTGT GGTCCAGTTTTTTTTTTTTTTTCCT
miR-241-3p AUUGUCUCUCAGCUGCUUCAUC AGATTGTCTCTCAGCTGCT GTCCAGTTTTTTTTTTTTTTTGATGAAG