Skip to main content

Table 2 Novel miRNA candidates in ‘Jinnan Shiqin’

From: High throughput sequencing of two celery varieties small RNAs identifies microRNAs involved in temperature stress response

miRNA ID Sequence (5′-3′) Length(nt) Start/end precursor Length of precursors(nt) Arm MFE (kcal/mol)
celery-miR-1 AAAATCGCTAGGCGGACCAGGGCG 24 66-166 101 3′ −19.36
celery-miR-4 ACAGGGGTCCATCACTATTAATAA 23 535-629 95 5′ −19.43
celery-miR-5 ACGAATTTAAAGATATTAACAATC 22 263-363 101 5′ −18.90
celery-miR-7 ACTGTAGTTTTCATTGGTTTTAC 23 1903-1999 97 5′ −20.40
celery-miR-9 AGTGATTGATCTGTTTTGAT 20 207-293 87 3′ −23.90
celery-miR-14 CGGAACCAGGATTTTTGATGTCC 23 93-194 102 5′ −30.10
celery-miR-16 GAACGGCGTCGGACGGAGCCGCCC 24 499-585 87 3′ −26.40
celery-miR-17 GCGGGCTGATCCGGGTTGAAGACA 24 13-107 95 3′ −24.70
celery-miR-19 GTTGTTATGTATTCGTTGTTATGA 24 551-645 95 3′ −19.43
celery-miR-20 GTTTTACTGCTAGAAGAAATGA 22 3431-3507 77 5′ −21.00
celery-miR-21 TAATGCTCTTCGTACTGCATC 21 1089-1186 98 3′ −33.50
celery-miR-24 TCCGGATTCTCCTTTTTTTCGAAC 24 9-99 91 3′ −19.30
celery-miR-27 TTTAGCTTGAACTATAGATT 20 1522-1617 96 3′ −24.90