Skip to main content

Table 1 Genomic features of prophages in Mycobacterium genomes

From: Prophage-like elements present in Mycobacteriumgenomes

Prophages Host Coordinate Insertion sites Size Putative attB regions of prophage-like elements References
phiMAV_1 M.avium 104 746,437-794,445 - 48.0 kb GGACCTGCGGATTAAAAGTC This study
phiMAV_2 1,446,840-1,463,298 - 16.5 kb GTGGTCAGCTT This study
phiMmcs_1 M.sp.MCS 3,067,419-3,080,311 tRNA-Pro 12.9 kb CCGTTGCCGT This study
phiMmcs_2 4,054,082-4,063,334 - 9.3 kb GGTGAGGGCGT This study
phiMkms_1 M.sp.KMS 3,085,307-3,098,199 - 12.9 kb CCGTTGCCGT This study
phiMkms_2 4,088,564-4,097,816 - 9.3 kb GGTGAGGGCGT This study
phiBN42_1 M.canettii CIPT 140070010 1,514,379-1,522,784 tRNA-Arg 8.4 kb GTGCCCCCGGCAGGATTCG This study
phiBN44_1 M.canettii CIPT 140060008 3,433,693-3,444,793 - 11.1 kb CCGGAGAAGAAGTCATGGTTCT This study
phiMCAN_1 M.canettii CIPT 140010059 1,180,578-1,191,783 - 11.2 kb GTTCGAGTCCGACTGGGGGCAC This study
phiMycsm_1 M.smegmatis JS623 4,221,770-4,232,715 - 10.9 kb GCCGACGACG This study
phiW7S_1 M.sp. MOTT36Y 968,527-980,490 tRNA-Ala 12.0 kb GTTCGCATCGAGTAGGTCAGGGGTTCGATTCCC This study
phiRv1a M.tuberculosis H37Rv 1,779,267-1,788,525 - 9.3 kb GGTTGGCCGTGG [8]
phiRv2a 2,970,063-2,980,853 tRNA-Val 10.8 kb CCGCGCAATAAACGCGCAATA [8]
phiMU01a M.ulcerans Agy99 NM NM 18 kb NM [9]
phiMU02a NM NM 24 kb NM [9]
phiMmar01a M.marinum M 27,047- 33,095 tRNA-Leu 6.0 kb NM [10]
phiMmar02a 4,812,334- 4,869,620 tRNA- Lys 57.8 kb NM [10]
phiMmar03a 5,460,072– 5,470,770 tRNA- Leu 10.7 kb NM [10]
phiMmar04a 5,628,721– 5,636,467 tRNA- Arg 7.7 kb NM [10]
phiMmar05a 5,884,651– 5,904,290 tRNA-Phe 19.6 kb NM [10]
phiMmar06a 2,567,503– 2,589,174 - 21.6 kb NM [10]
phiMmar07a 3,082,858– 3,100,046 tRNA- Pro 17.2 kb NM [10]
phiMmar08a 3,808,513-3,851,917 tRNA-Leu 43.0 kb NM [10]
phiMmar09a 688,611-695,966 tRNA-Gly 7.4 kb NM [10]
phiMmar10a 4,405,758- 4,430,810 tRNA-Met 25.1 kb NM [10]
Prophage Araucariaa M.abscessus subsp. bolletii BD Contig17 NM (1,000-65,113) - 64.1 kb NM [6]
phiMAB_1# M.abscessus ATCC 19977 1,754,551-1,835,095 tRNA-Met 80.5 kb NM [11]
phiMAB_2# 233,621-247,981 tRNA-Arg 14.4 kb NM [11]
phiMAB_3# 770,916-778,753 tRNA-Lys 7.8 kb NM [11]
phiMAB_4# 4,909,957-4,959,626 - 49.7 kb NM [11]
phiMAB47J26_1# M.abscessus Strain 47 J26 Contig02 NM (55,744-116,295) NM (tRNA-Leu) 60.5 kb NM (GCGGACTTAAAATCCGCCAAGTGTCGGTTCGAGTCCGACTGGGGGCAC) [12]
phiMAB47j26_2# M.abscessus Strain 47 J26 Contig03 NM (58,656-105,841) - 47.2 kb NM [12]
phiOUW_1# M.abscessus M93 Contig09 NM (267,663-342,276) NM (tRNA-Arg) 74.6 kb NM (GTGCGCCCGAAGGGATTCGAACCCCTAACCTTCTG) [13]
phiM172_1# M.massiliense Strain M172 Contig06 NM (358,576-422,610) NM (tRNA-Val) 64.0 kb NM (TTGGTGGGCGCGGAGGGTTTCGAACCC) [14]
phiM172_2# NM (456,450-513,710) - 57.3 kb NM (CAACCAGTCGGCCTGA) [14]
phiSTB-I_1# M.canettii STB-1 (CIPT 140070007) NM tRNA-Lys 55 kb NM [15]
phiDSM_1# M.simiae DSM 44165 NM NM 40 kb NM [16]
phiDSM_2# NM NM 7 kb NM [16]
phiDSM_3# NM NM 18 kb NM [16]
  1. NM means that these data do not be mentioned; parentheses means that these data is shown in this study; - means these prophages are not integrating into tRNA genes; athose prophages has been described and named; #those prophages has been described, but did not be named.