Skip to main content

Table 3 Summary of newly identified 55 novel miRNAs in the five wheat libraries or tissues

From: Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)

miRNA Mature sequence(5′→3′) Length (nt) Abundance (RPM)§
Seedlings Flag leaves Developing seeds*
tae-miR1120b UUCUUAUAUUGUGGGACAGAG 21 26 131 56
tae-miR1120c UAAUAUAAGAACGUUUUUGAC 21 0 24 0
tae-miR1122b AGACUUAUAUGUAGGAACGGA 21 0 0 10
tae-miR1122c UCUAAUAUUAUGGGACGGAGG 21 4 8 4
tae-miR1127b ACAAGUAUUUCUGGACGGAGG 21 0 0 17
tae-miR1130b UCUUAUAUUAUGGGACGGAGG 21 0 10 0
tae-miR1137b UCCGUUCCAGAAUAGAUGACC 21 9 13 28
tae-miR167c UGAAGCUGCCAGCAUGAUCUGC 22 67 173 88
tae-miR1847 ACCUGCAGUUGGGCCAAUGAC 21 47 106 20
tae-miR2275 UUUGGUUUCCUCCAAUAUCUCG 22 0 0 12
tae-miR396 AACUGUGAACUCGCGGGGAUG 21 6 11 35
tae-miR397 UCACCGGCGCUGCACACAAUG 21 2 92 5
tae-miR5048 UUUGCAGGUUUUAGGUCUAAGU 22 1,142 1,274 0
tae-miR5049 AAUAUGGAUCGGAGGGAGUAC 21 1 13 1
tae-miR5062 UGAACCUUAGGGAACAGCCGCAU 23 510 1,509 2,932
tae-miR5175 UUCCAAAUUACUCGUCGUGGU 21 0 129 34
tae-miR5384 UGAGCGCGCCGCCGUCGAAUG 21 0 12 0
tae-miR6197 UCUGUAAACAAAUGUAGGACG 21 29 71 131
tae-miR7757 AUAAAACCUUCAGCUAUCCAUC 22 67 83 78
tae-miR9652-3P AAGCUUAAUGAGAACAUGUG 20 0 14 1
tae-miR9652-5P CCUGUUUGUCAUUAAGUUUCUU 22 2 0 10
tae-miR9653 UUUGAGACUUUGGCCAUGGCC 21 0 0 15
tae-miR9654a UUCUGAAAGGCUUGAAGCGAAU 22 0 0 135
tae-miR9654b UUCCGAAAGGCUUGAAGCGAAU 22 1 3 34
tae-miR9655 CAAGGGAAGGAAGUAGCCAAC 21 15 1 1047
tae-miR9656 CUUCGAGACUCUGAACAGCGG 21 0 0 18
tae-miR9657a UGUGCUUCCUCGUCGAACGGU 21 0 0 46
tae-miR9657b UUCGUCGGAGAAGCAUGUUGC 21 0 0 60
tae-miR9657c CGUGCUUCCUCGUCGAACGGU 21 16 39 29
tae-miR9658 AUCGUUCUGGGUGAAUAGGCC 21 7 10 299
tae-miR9659 UCCAAUGGUUGUUCACGGCAUC 22 0 0 248
tae-miR9660 UUGCGAGCAACGGAUGAAUC 20 0 0 21
tae-miR9661 UGAAGUAGAGCAGGGACCUCA 21 2 1 27
tae-miR9662a UUGAACAUCCCAGAGCCACCG 21 402 488 898
tae-miR9662b UGAACAUCCCAGAGCCACCGG 21 0 488 821
tae-miR9663 AAGCGUAGUCGAACGAAUCUG 21 1,634 5,562 10,441
tae-miR9664 UUGCAGUCCUCGAUGUCGUAG 21 243 305 1122
tae-miR9665 GCUAGCAGUGUAAACUCAAAUCA 23 0 0 9
tae-miR9666a CGGUAGGGCUGUAUGAUGGCGA 22 46 47 1,519
tae-miR9666b CGGUUGGGCUGUAUGAUGGCGA 22 8,913 29 477
tae-miR9666c GCCAUCAUACGUCCAACCGUG 21 10 0 0
tae-miR9667 AAAUAUGGCAAACAAUGAAUG 21 0 0 27
tae-miR9668 CCAAUGACAAGUAUUUUCGGA 21 0 10 9
tae-miR9669 UACUGUGGGCACUUAUUUGAC 21 9 0 0
tae-miR9670 AGGUGGAAUACUUGAAGAAGA 21 140 218 409
tae-miR9671 UGACUUUACACAACUGUCCGGC 22 6 13 0
tae-miR9672 CCACGACUGUCAUUAAGCAUC 21 92 366 36
tae-miR9673 UAAGAAGCAAAUAGCACAUG 20 4 14 11
tae-miR9674a GCAUCAUCCAUCCUACCAUUC 21 143 346 337
tae-miR9674b AUAGCAUCAUCCAUCCUACCC 21 362 453 817
tae-miR9675 UUUAUGAUCACUCUCGUUUUG 21 0 32 0
tae-miR9676 UGGAUGUCAUCGUGGCCGUACA 22 57 63 19
tae-miR9677 UGGCCGUUGGUAGAGUAGGAGA 22 1 9 344
tae-miR9678 UCUGGCGAGGGACAUACACUGU 22 4 0 411
tae-miR9679 CAGAACCAGAAUGAGUAGCUC 21 15 32 59
  1. The mature sequence bold were previously described in wheat (Wei et al., 2009 [26]; Meng et al., 2013 [24]).
  2. §Abundance reflected by normalised reads (reads per million of total miRNA reads, RPM).
  3. *Including 5-d seeds, 10-d seeds, and 20-d seeds, thereby the abundance referring to the total of abundance of each miRNA in the three stages of developing seeds.