Skip to main content

Table 4 List of oyster genes targeted by real time PCR

From: Dual transcriptomics of virus-host interactions: comparing two Pacific oyster families presenting contrasted susceptibility to ostreid herpesvirus 1

GenBank EST name Abbreviation Forward primer Efficiency (%) Primer reference
    Reverse primer   
DQ530619 Myeloid differentiation factor 88 MyD88 CGTGCCATGGACGGATAACAACG 97.5 [20]
GGCCCAGCAGTACCTCTGTGGAATC
AM856743 NF-Kappa-B-inhibitor cactus IkB2 CAGCATTCACTGACGACGAT 104 [14]
TCTGCCTCAGTTTGTCGTTG
FJ440108 Interferon Induced Protein 44 IFI44 TGGTGGACTATGGACCGGACAGTG 93.8  
GGTAGACAGTGGTGAGGCTGTGCT
EU678311 Glypican Gly AACTACTGCCTCAACACCATGAA 102.1  
TAGGTGTCACCAACAGAACCAC
JH818926 Baculoviral IAP repeat-containing protein 2 IAP CCCGAAAACGTAACCTCAGA 103 Barbosa-Solomieu et al., pers com
TTTCGTTTGCTGCTCATTTG
AB122066 Elongation Factor EF AGTCACCAAGGCTGCACAGAAAG 98.8  
    TCCGACGTATTTCTTTGCGATGT