Skip to main content

Table 1 Genes analyzed by quantitative real-time PCR

From: Gene expression profiling of mesenteric lymph nodes from sheep with natural scrapie

Gene Primer sequence Size (bp) Accession number
BBOX1 F: TGCAAACAATGTGGCTTACACA 85 NM_001101881.2**
  R: AAGCTGAACCCCAGGTGGAT   
CP F: GCAGCCAGATACTGCAGGGAC 97 NM_001009733.1*
  R: CCCGCACTGGCTCACAGTATAT   
PFDN2 F: GCAGGTAATTGCTGGCTTCAA 84 NM_001080221.2**
  R: TTCAACTCCATCTCCAGCTCAG   
PSMA7 F: TAATGTCTGCATGGCATTCGC 81 NM_001034233.2**
  R: TGGCTCTGGCATTCCACC   
SERPINE1 F: TGTACGTGTCGCAGGCGC 83 NM_174137.2**
  R: TACAAGGGCTGTGGAGGAGGAC   
UCHL1 F: AACTTGATGGACGGATGCCTT 84 NM_001046172.2**
  R: TGCAGACCTTGGCAGCGT   
VEGFA F: GGGCTGCTGTAATGACGAAAGT 81 NM_001025110.1*
  R: GGTTTGATCCGCATAATCTGCA
  1. *Ovine cDNA.
  2. **Bovine cDNA.
  3. Primers (F, forward; R, reverse) used for gene amplification, amplicon size and GenBank accession numbers for the bovine cDNA sequences used for primer design.