Figure 2From: A SNP in intron 8 of CD46 causes a novel transcript associated with mastitis in HolsteinsExonic splice enhancer (ESE) motif threshold scores associated with CD46 genotypes. Bar graphs represent scores above the threshold for the ESE motifs within the ancestral (wild) and mutant haplotypes. The arrows indicates that the signal for the SRSF2 and SRSF5 motifs disappear when the mutation (c. 1033 + 2184 C > T) is introduced into the wild-type sequence. Wild type (C) sequence: attccaagcccacttctccaaccatgacttcaggactaagtcatccag; Mutant type (T) sequence: attccaagcccacttctccaaccatgactttaggactaagtcatccag.Back to article page