Comparative genomics highlights the unique biology of Methanomassiliicoccales, a Thermoplasmatales-related seventh order of methanogenic archaea that encodes pyrrolysine

Table 2 ORBs motifs found in the Methanomassiliicoccales genomes

ORB	Sequence	Position	Spacing	Orientation	Comment
“Ca. M. alvus” ORB1	GTTCCAGTGGAAATGG-TGGGGT	78 - 99	39	inverted	downstream orc1/cdc6.1
“Ca. M. alvus” ORB2	GTTCCACTGGAAACAG-AGGGGT	138 - 159	39	inverted	downstream orc1/cdc6.1
“Ca. M. alvus” ORB3	TTTCCACTGGAAACAG-AGGGGT	1977 - 1998	47		upstream orc1/cdc6.1
“Ca. M. alvus” ORB4	GTTCCACTGGAAATGG-TGGGGT	2045 - 2066	47		upstream orc1/cdc6.1
“Ca. M. intestinalis” ORB1	ATTACAGTGGAAATGA-AGGGGT	15 - 36	256	inverted	downstream orc1/cdc6.1
“Ca. M. intestinalis” ORB2	TTTGCAGTGGAAATGA-AGGGGT	292 - 313	256		downstream orc1/cdc6.1
“Ca. M. intestinalis” ORB3^a	GTTCCAGTGGAAATGA-AGGGGT	795626 - 795647			downstream fstZ
“Ca. M. intestinalis” ORB4^a	TCTGCACTGGAAATGA-AGGGGT	1576211 -1576232		inverted	downstream fused nifH/nifE
M. luminyensis ORB1	GTTCCATTGGAAATCG-GCAGGA	73488 - 73475^b	113		downstream orc1/cdc6.1
M. luminyensis ORB2	GTTCCAGTGGAAATAA-AGGGGT	73341 - 73362^b	113	inverted	downstream orc1/cdc6.1
Methanomassiliicoccales consensus ORB	GTTCCAGTGGAAATGG-AGGGGTA
Archaea consensus ORB	CTTCCAGTGGAAACGAAAGGGGT				Pelve et al., [40]

Bases in bold indicate consensual bases of the ORB sequence in the Methanomassiliicoccales. The “Ca. M. alvus” ORBs, and the ORB2 of M. luminyensis and “Ca. M. intestinalis” might be extended by a “GGGGGT” sequence otherwise not conserved in the 4 other Methanomassiliioccales ORBs and the Archaea consensus ORB.
^aNot found in close association to another ORB.
^bContig [GenBank: CAJE01000021.1].

ISSN: 1471-2164