Skip to main content

Table 2 ORBs motifs found in the Methanomassiliicoccales genomes

From: Comparative genomics highlights the unique biology of Methanomassiliicoccales, a Thermoplasmatales-related seventh order of methanogenic archaea that encodes pyrrolysine

ORB Sequence Position Spacing Orientation Comment
Ca. M. alvus” ORB1 GTTCCAGTGGAAATGG-TGGGGT 78 - 99 39 inverted downstream orc1/cdc6.1
Ca. M. alvus” ORB2 GTTCCACTGGAAACAG-AGGGGT 138 - 159 inverted downstream orc1/cdc6.1
Ca. M. alvus” ORB3 TTTCCACTGGAAACAG-AGGGGT 1977 - 1998 47   upstream orc1/cdc6.1
Ca. M. alvus” ORB4 GTTCCACTGGAAATGG-TGGGGT 2045 - 2066   upstream orc1/cdc6.1
Ca. M. intestinalis” ORB1 ATTACAGTGGAAATGA-AGGGGT 15 - 36 256 inverted downstream orc1/cdc6.1
Ca. M. intestinalis” ORB2 TTTGCAGTGGAAATGA-AGGGGT 292 - 313   downstream orc1/cdc6.1
Ca. M. intestinalis” ORB3a GTTCCAGTGGAAATGA-AGGGGT 795626 - 795647    downstream fstZ
Ca. M. intestinalis” ORB4a TCTGCACTGGAAATGA-AGGGGT 1576211 -1576232   inverted downstream fused nifH/nifE
M. luminyensis ORB1 GTTCCATTGGAAATCG-GCAGGA 73488 - 73475b 113   downstream orc1/cdc6.1
M. luminyensis ORB2 GTTCCAGTGGAAATAA-AGGGGT 73341 - 73362b inverted downstream orc1/cdc6.1
Methanomassiliicoccales consensus ORB GTTCCAGTGGAAATGG-AGGGGTA     
Archaea consensus ORB CTTCCAGTGGAAACGAAAGGGGT     Pelve et al., [40]
  1. Bases in bold indicate consensual bases of the ORB sequence in the Methanomassiliicoccales. The “Ca. M. alvus” ORBs, and the ORB2 of M. luminyensis and “Ca. M. intestinalis” might be extended by a “GGGGGT” sequence otherwise not conserved in the 4 other Methanomassiliioccales ORBs and the Archaea consensus ORB.
  2. aNot found in close association to another ORB.
  3. bContig [GenBank: CAJE01000021.1].