Skip to main content

Table 1 Top 30 novel miRNAs in P. alecto

From: Characterisation of novel microRNAs in the Black flying fox (Pteropus alecto) by deep sequencing

miRNA miRDeep2 score Mature reads Loop reads Star reads Mature sequence Top BLAST hit
pal-can-034 1273.2 2480 0 11 augaccuaugaaucgacagaca cgr-miR-215-5p
pal-can-081 145.7 267 0 10 accugugcccuucugaguagc rno-miR-465-3p
pal-can-091 91.6 130 0 41 aauggcaccuuucugaguagu ppy-miR-513a-2-3p
pal-can-101 69.3 111 0 23 ugcugcucagggacggggcga  
pal-can-102 69.2 131 0 3 ugcuagggcuagagagcgagugc  
pal-can-103 61.3 106 0 6 ugauugacagcuuugagagugg cfa-miR-514
pal-can-119 37.1 33 0 38 gaccuaagcccuucugaguau  
pal-can-125 30.1 45 0 5 caacucuaaggggcaucauuca  
pal-can-133 23.5 36 0 8 cgccuagaugaugccuuucuu ppy-miR-337-3p
pal-can-140 15.3 11 5 12 aaaugguacccuagugacuaca rno-miR-224-3p
pal-can-157 6.6 11 0 1 uaacaggcauuucugagguga  
pal-can-187 5.5 81 0 0 uuuccggcuuagugggugugu eca-miR-1180
pal-can-179 5.5 38 0 4 uacucagaaggggccagguuac  
pal-can-195 5.4 38 0 4 uacucagaaggggccagguuac  
pal-can-227 4.9 25 0 0 aucucgguggaaccucca  
pal-can-231 4.8 44 0 0 gagagaucagaggugcagagu bta-miR-6529
pal-can-245 4.5 10 0 0 uugcagcugccgggagugauuu eca-miR-1301
pal-can-247 4.3 10 0 0 aggggcagcaugguguagcag  
pal-can-249 4.3 50 0 0 uagguaguuucuuguuguuggg ssc-miR-196b
pal-can-254 3.8 267 0 0 cagaagaguagauugauuggu  
pal-can-257 2.9 69 0 0 agagguaaaaauuugauuuga bta-miR-6119-5p
pal-can-263 2.5 43 0 0 aggaauguaaagaagcaugu  
pal-can-271 2.1 69 0 0 acaucaagacuaggcauacacug  
pal-can-276 1.8 162 0 0 aagggguucugccgucgguc oar-miR-541-5p
pal-can-278 1.8 12 0 0 aucucgcuggggccucca  
pal-can-280 1.7 25 0 0 ucaagucccuguucgggcgcca mmu-miR-5097
pal-can-290 1.5 23 0 0 ugggggagagaacagguagaca  
pal-can-303 1.2 14 0 0 aauuugggccuuucugaguaga age-miR-506
pal-can-307 1 15 0 0 agccuugugacugacgaucggaca  
pal-can-316 0.9 10 0 0 uucgcaagaaggugucauucau age-miR-513c