Skip to main content

Table 3 Microarray gene expression validation

From: Toxicity evaluation of manufactured CeO2 nanoparticles before and after alteration: combined physicochemical and whole-genome expression analysis in Caco-2 cells

Gene ID Primers (5′-3′) Microarray Fold change CeO2/Ctrl qRT-PCR Fold Change CeO2/Ctrl
ATP5J F:GTCAGCCGTCTCAGTCCATT −1.94 −1.75
R:AAAAGCTCCCTCTCCAGCTC
NDUFA4 F:TCCAGATGTTTGTTGGGACA −2.31 −5.52
R:GTGGAAAATTGTGCGGATGT
NDUFS7 F:CGCAAGGTCTACGACCAGAT −1.68 −2.39
R:TCCCGCTTGATCTTCCTCT
PRDX5 F:GTGGTGGCCTGTCTGAGTGT −1.95 −1.74
R:ATGCCATCCTGTACCACCAT
Gene ID Primers (5′-3′) Microarray Fold change NB-DA / Ctrl qRT-PCR Fold Change NB-DA / Ctrl
PRDX3 F:GTTGTCGCAGTCTCAGTGGA R:GACGCTCAAATGCTTGATGA −2.65 −2.98
SDHD F:GTATGCCTCTTTGCCTCTGC R:GAGGCAACCCCATTAACTCA −1.84 −4.45
COX6A2 F:CTACCAACACCTCCGCATC R:TCGAAGCTTCACACCTTTATTG −2.03 −2.08
Gene ID Primers (5′-3′) Microarray Fold change NB-DL / Ctrl qRT-PCR Fold Change NB-DL / Ctrl
SDHC F:TTGAGTGCAGGGGTCTCTCT R:AACCAGGACAACCACTCCAG −2.26 −16.30
SDHD F:GTATGCCTCTTTGCCTCTGC R:GAGGCAACCCCATTAACTCA −2.03 −22.10
  1. F = forward; R = reverse.
\