Skip to main content

Table 7 Primers used for PCR and Sanger sequencing

From: Genome resequencing and bioinformatic analysis of SNP containing candidate genes in the autoimmune vitiligo Smyth line chicken model

Gene Primer name Primer sequence (5′→3′)
EFHA1 Forward CAAAAACCTAAATGGGTTTCCA
Reverse AAACTTCATCAGGACATGCAGA
Sequencing GTGCAAGTTTCTGAAAGACT
EPRS Forward CAATTCCACACTTTGCAGGTTA
Reverse GCTGTGATGCCAAATTTAAACA
Sequencing GAAGGGAAGGCATATGTGGA
ERAL1 Forward AGGACACACACATGCTGGATAC
Reverse GCCCTTTTTGTGTTTTAAGTGG
Sequencing GAGACTTCCTTGGGACCACA
LOC100859401 Forward GAATTTACCAGTCCAGGCACTC
Reverse ACTACCTTGGGCCTTGTCAGTA
Sequencing ATGCTCCTTTTTTCCAGACC
LOC770458 Forward TGCAGAGAATACAGCACGATCT
Reverse ACTCACTCCATAAGGGGAGACA
Sequencing GCCTTTACCAGACAAA
SPTSSB Forward CTTGTTGGGAATCAGCTCTCTT
Reverse TGCCTTTGTCAATACTGTGACC
Sequencing AACGCAGAGTCCTAACGTGG
STAB2 Forward CACTGTTACTGCAGTGATGCAA
Reverse GATAGGAACAGCATCCCTAACG
Sequencing GCACTGGCACGTGTTGTTCT
SYNE1 Forward ACTCACCTTGTGGTTGGCTAGT
Reverse CCTCACTGTCTTCCTCTGCT
Sequencing CCAGCCTGCTAGACATATGT
SETD4 Forward CAAATCGTTGTCACGTTCAAGT
Reverse TTCCTTTTGGTGTGCTTCCTAT
Sequencing AGATCTTCCA AGCGTAGTGC
GEMIN5-1 Forward TAGGCTTCATTTGCTGACTCAA
Reverse TACAGCAGGAAGGAAGGATGAT
Sequencing CCCTTTCTTTTCCAAAGGTG
GEMIN5-2 Forward CCTGGGATGAGGTAGTGAAAAG
Reverse AAGCAGAAAAGCAAAAGCAGAC
Sequencing ATTCTTGGTGCTGTGGCCCG
KIAA1409_1 Forward CTTTGGGCTTAGAGAACAGCAT
Reverse AAATTCAGTGGCATTTTTGCTT
Sequencing GGGGTGGTTCTCACACATGTCA
\