Skip to main content

Table 3 Human peptide transporter (SLC15A1) : PCR Primers and Annealing temperature

From: Mutation screening of two candidate genes from 13q32 in families affected with Bipolar disorder: human peptide transporter (SLC15A1) and human glypican5 (GPC5)

Exon cDNA bp Position Forward Primer
Primer sequence 5' → 3'
Reverse Primer
Primer sequence 5' → 3'
Product Size bp Annealing Temp.
2 61–77 P17 ccctctgaccaccctaaaaa tgaacccttaggggtaaaaca 191 60
3 78–159 P1 tggggaaggattagtgtaggg aactttcccagccacgagt 498 60
4 158–302      
5 302–422 P2 tgtggtggagtcaaaagtgg cctgaagacccagctcaatc 356 60
6 422–522 P3 gtcactatgccaggcccact gcctctgactcctggatgtg 258 60
7 519–611 P18 agtggattgatagccaaagtcatct aagacacggacttggcctta 200 60
8 611–696 P4 tgtgaaagcaatacgtaattatcag ctactttttgttgccacttgttacat 295 60
9 697–779 P16 tcaagagccatttctattcttcc gcatctctctaggccacagg 350 48
10 780–867 P5 tgaaatgtgcttccctgaca tcactgaccattttgtccatgt 254 60
11 867–957 P6 acctcccagcttgcctcta tgaagtgagccttggtacctg 293 60
12 955–1002 P7 cagggtactgctttgtgcag tatcctctaggcgaggttgc 701 60
13 1002–1034      
14 1030–1123      
15 1124–1205 P8 aagatggggagaggtgcttt gctccagggctcagtttaca 348 60
16 1206–1325 P9 aggtctgtgattggcagctt gctggccttggcatttatac 379 60
17 1326–1476 P10 aaacctcatgacggtgtctg ttttggcctccagtatcaca 400 60
18 1472–1522 P11 gcctccagagcccttctaat tcagccagccttacattgct 331 60
19 1519–1630 P12 gacattgtggcggaatctct gggagtattgcccaacttca 356 60
20 1631–1739      
21 1738–1884 P13 gtcccatcagcattttctgc ggtcaaactcaatttacctgttcg 292 60
22 1879–1991 P14 ccatgatgaccatgaacagg cattgaggccacctgacttt 299 60
23 1993–2315 P15 ccaagaacatgtacgcacca aggctgaggcaggagaatta 540 60