Skip to main content

Table 2 Primer sequences for RT-PCR amplification of regional genes.

From: A transcription map of the 6p22.3 reading disability locus identifying candidate genes

Gene Forward primer Reverse primer Product size
AP3 GTTTGTTGTCAGATCCTCCA ATCATCAGGGAGACTTTCCA 97 bp
CMAH TGGAAAACAAAGCATAGCTG CGAAAACAGACCATTTCCAG 105 bp
Cyclophilin A TTCGAGTTGTCCACAGTCAG CAAAGTGAAAGAAGGCATGA 106 bp
Cytokeratin 8 CCTCATCAAGAAGGATGTGGA GCCTGAGGAAGTTGATCTCG 95 bp
UBE2D2 ATGGCAGCATTTGTCTTGAT TTGGGATCACACAACAGAGA 100 bp
FLJ12619 CTTTACAAGGGTGTTTTGGAG TGCACAAAATGAGTTCTGCT 108 bp
FLJ12671 CTCCACCAGCTCCACATCTT GTTGGGTTCTGACGTGAAGG 12 bp
Geminin CGTGTGCTGAAGGAACTGTA GGAGGTAAACTTCGGCAGTA 103 bp
GPLD1 CATGGTGAGCATTTTGATGG GTGGCTGTTGGTGTGTGTCT 103 bp
HT012 TTTCCCAGGTGTTTTGTGTG GCACATGTTCTGAAGCAAGG 110 bp
KIAA0319 GGATTCATACCCATGGCATT TCACTGGCTTGTTGAGTGGT 105 bp
KIAA0386 TCAGGTCCCATTATTGCTTC CCCCACCTTGTACACTCTTT 117 bp
RPS10 CATCAAGGGAATGGGTACTG TTTACAACAATGCCAACAGC 108 bp
MRS2 ATGAGGCAACACAAGCACAG GGCTTGTCAAGTTCCTACGC 100 bp
NUP50 GAAGATGGAGGTGGCATCTG TAATGAGCCCAAAACAGAGC 109 bp
P24 CATGCATACACAGGGTGCTT GAATGCGCCATTAAAAGGAA 119 bp
RU2AS TAGCAGGTGAACCTGGTGTG GCTTGCAGGACTCGGAGTAG 97 bp
SSADH GGAGCACCTCTCCCTATTCC TGAAGTGGCAAACAGGACAG 107 bp
TRAF TTCAGGATGTGAGGCCATTT CAATGGGGTACCTGTTTGGA 100 bp
S15 TTCCGCAAGTTCACCTACC CGGGCCGGCCATGCTTTACG 361 bp