Skip to main content

Table 8 EST loci used in a population-level PCR amplification screen in A. ordinarium

From: From biomedicine to natural history research: EST resources for ambystomatid salamanders

Locus ID Forward Primer 5' to 3' Reverse Primer 5' to 3'
1F8 AAGAAGGTCGGGATTGTGGGTAA CAGCCTTCCTCTTCATCTTTGTCTTG
1H3 GGCAAATGCTGGTCCCAACACAAA GGACAACACTGCCAAATACCACAT
2C8 GCAAGCACCAGCCACATAAAG GGCCACCATAACCACTCTGCT
3B10 TCAAAACGAATAAGGGAAGAGCGACTG TTGCCCCCATAATAAGCCATCCATC
5E7 ACGCTTCGCTGGGGTTGACAT CGGTAGGATTTCTGGTAGCGAGCAC
5F4 CCGAGATGAGATTTATAGAAGGAC TAGGGGAAGTTAAACATAGATAGAA
6A3 GTTTATGAAGGCGAGAGGGCTATGACCA ATCTTGTTCTCCTCGCCAGTGCTCTTGT
6B1 TGATGCTGGCGAGTACAAACCCCCTTCT TTTACCATTCCTTCCCTTCGGCAGCACA
6B3 ACCACGTGCTGTCTTCCCATCCAT ACGAAGCTCATTGTAGAAGGTGTG
6B4 CCCACGATGAATTGGAATTGGACAT CTGCCTGCCAGACCTACAGACTATCGT
6C4 ATGGCGCCAAAGTGATGAGTA GGGCCAGGCACACGACCACAAT
6D2 ATCAAGGCTGGCATGGTGGTCA GGGGGTCGTTCTTGCTGTCA
6H8 GAAGAAGACAGAAACGCAGGAGAAAAAC CGGGCGGGGGCGGGTCACAGTAAAAC
BL005B_A01.5.1 GACAGGTCATGAACTTTTGAAAATAA AAAGTATATGTACCAAATGGGAGAGC
BL006A_G07.5.1 GATGTCCTCTCCACTATACAAGTGTG GTTTGACTTGTCACCACTTTATCAAC
BL012D_F02.5.1 ACAGCCAGAAATAGAAACTTTGAACT TGAAAGTATGTATTGTTTTCACAGGG
BL013C_E01.5.1 AGGATGAAATAATATGCTGTGCTTC ACCGTGATAAACTCCATCCCTT
BL014D_B11.5.1 AGCAAAACTCCTCTATGAATCTCG ATTGCACACTAAATAGGTGAATACGA
BL279A_G10.5.1 ATGGCAGGATGAAGAAAGACAT ATGCACTTTGGACCCACTGAG
Et.fasta.Contig1023.5.1 TGTGGTTATTGGACTACTTCACTCTC AAACGTCCATTTGACACTGTATTTTA
Et.fasta.Contig1166.5.1 GAATGAAGAGAAAATGTTTTGAAGGT GCACAGTATTGGCTATGAGCAC
Et.fasta.Contig1311.5.1 AGAAAACTGTGTCAAGCTTATTTTCC CAACTTAGTGTTCACATTTCTGAGGT
Et.fasta.Contig1335.5.1 CCACTTATGGTAGTTCCCACTTTTAT GCTAAAGAATACCAAGAACCTTTGAC
Et.fasta.Contig1381.5.1 GTCACAGGTATAACATTGAAAGGATG TAAATGAATCAAACATTGAAGAGAGC
Et.fasta.Contig1459.5.1 ATAACAAGGACATGTTCTGCTGG CTAGCAGAACCCTGTATAGCCTG
Et.fasta.Contig1506.5.1 AGGATATCCGCTCAGAAATATGAAG CTGACCACTTGCAAAACTTACTACCT
Et.fasta.Contig1578.5.1 CCTAGAACATTACCAAAACAGACTCA AATGAAGAAGTATTGCATGTGAGAAC
Et.fasta.Contig1647.5.1 GTACAACGTCAGGCAAAGCTATTCT ATCTCCAACACCGTGGCTAAT
Et.fasta.Contig1717.5.1 GAACTTGTTGGCAGGTTTCTCTT CTAGTGATAGGTTGGACATACCAGAG
Et.fasta.Contig1796.5.1 TGTGGGTATGTATATGGCTAACTTGT AGATTTTATGTGCTACTGCATTTACG
Et.fasta.Contig1908.5.1 CTCATGACTTAATTGCTGTTCTTCG ATAACCATTCTGAGGTTTTGAGTTG
Et.fasta.Contig1941.5.1 ATCTCCTGCTTCATCTCTTGATTTAT TAACAGATTTAATAAACGTCCCCTTC
Et.fasta.Contig1943.5.1 AGTACGATGAATCTGGTCCTTCAAT CCACAATACTGACATACTCTGGTCTT
Et.fasta.Contig325.5.1 GTGAAGTCAGTGAGTAAAGTCCATGT CTAGGATACCAGTGGGAGAGTGTAAT
Et.fasta.Contig330.5.1 GTCATCACCTCCACTACTTCACAAG TTTTGGCACTGTAAGATTCTATGAAC
Et.fasta.Contig536.5.1 CCTTAGGTAGAACAGACTGAAGCAG GAAACATGAAACTGGACTTGTTTTAG
Et.fasta.Contig917.5.1 GGATGCAGATTCTTCCTATTTTACTC CTGGTCACTTTACTTGTTTTCAGTGT
Et.fasta.Contig926.5.1 TTCATCACATTCTACTTCACAAATCA CTAGGCAAGCAAGCTTTCTAATAGTT
Et.fasta.Contig93.5.1 GAATAAAAGCAACAATTGCAGAGTTA CTCGACTCCTTCTACGATCTCTACTC
Et.fasta.Contig990.5.1 GTTTAGGTTAGTATGAAGGATCCCAA TGCCAGTACTCACCAATTAGTAAAAG
G1-C12 CCCAAATCCAGGAGTTCAAA TGGGACCTGGGGCTTCATT
G1-C13 TTGCCCGAGAAAAGGAAGGACATA CAAGGGTGGGTGAGGGACATC
G1-C5 F-CACTGTTGACTTGGGTTATGTTATT CTGCTCCTAGGGTTTGTGAAG
G1-C7 CCCGTGTGGCTGGCTTGTGC TCGGCTACTTTGGTGTTTTTCTCCCTCAT
G1-C9 TGGTCCGGCAACAGCATCAGA GCTTTTCGGTATTCAACGGCAGAGTG
G1-C9 TGGTCCGGCAACAGCATCAGA GCTTTTCGGTATTCAACGGCAGAGTG
G1-D5 AGACCCTTGCTGTGTAACTGCT GACTGGGACTGACTTCTATGACG
G1-D6 CAGCGTGCCCACCCGATAGAA TCCCAAAAAGTAAAATGTGCAAAGAAAA
G1-D7 CAGCGGTGGAAATGACAAACAGG CCAAGACGACGAGGAACGGTATT
G1-E12 CAACCATGAGAGGAGGCCAGAGAAC AAAACAGCACTACCTACAAAACCCTATT
G1-F1 TTAGTTTGGGTGCAGACAGGA GGTGCTCAACAACAAATCAACT
G1-F20 TCCCCAACAACTCCAGCAGAT GGAAACCACCTAGACGAAAAATG
G1-I18 CATGTTTGTGGGTGTGGTGAA AAAAGCGGCATCTGGTAAGG
G1-I19 ACCCAGACCTGTCCACCTCA GAACAGCTCTCCAATCCACAAG
G1-I21 CCAAGCGAAGGAGGCGTGTG CATGTGGCTCTTTGTTTCTGGA
G1-I5 TAATCGTGTTTGGTGGCATCCTTGAGTC AGCAGCAGTTCCATTTTCCCACACCA
G1-I8 ACCTGCAGTGGGCTAAGACC ATGGAAATAATAAAATAAAATGTT
G1-J10 CGTTCGCTTTGCCTGCCACA GGCTCTTCCCCGGTCGTCCAC
G1-J17 AGCGCCTTCTACACGGACAC TATGCCCCAATTACTCTTCTGC
G1-J2 TACAGTAACTATGCCAAGATGAAATG CAATATGGATAATGGCTGTAGACC
G1-J20 ATCCTCCAAGCTCACTACAACA CCAGCCCCTTCCCAAACAG
G1-J9 CTGTCATTGCCTGCATCGGGGAGAAG TGTTGAGGGGAAGCAGTTTTG
G1-K2 GCTTTCGCCTTTGACACCTC GGCCGGACCATTGCTGAAGAAG
G1-L11 AAAGTGACCATCCAGTGCCCAAACCT CCGGCCGAAACTGACGAGATACATTAG
G1-L13 TCAGCTGCACTAGGTTTGTC CATTTTGATTTGCTCCATAA
G1-L19 GACAACCTTGAATCCTTTATG AGATGTTGGTTGGTGACTTAT
G1-L20 TGGGCATAGATGGCAAGGAAAAA CCCCCAGCATCTCGCATACAC
G1-L7 GTGCTACAGGAAGGAATGGATG TAGCACAGGAACAGCCGACAATAA
G1-M14 CCGCTTGGACATGAGGAGAT TGGCAAAGAAACAGAACACAACTA
G1-M19 GAGAAGTAGTGTCCCGGCAGAAAC ATGGGTGAAAACTTAGGTGAAATG
G1-N9 GCGGGGCAATACATGACGTTCCACAG GACCCCCATCTCCGTTTCCCATTCC
G1-O1 GGGGTAGAGCACAGTCCAGTT TTGCAAGGCCGAAAAGGTG
G1-O12 GGAATTCCGGGGCACTACT TCGCGAGGACGGGGAAGAG
G1-O24 CGGCCTTCCTGCAGTACAACCATC TCGGCAACGTGAAGACCATA
G2-A11 GCCCCTGGAAGCTGTTGTGA GGGGTCCATCCGAGTCC
G2-A7 TTACCCCACAGACAAAATCAACACC GGCGGCCCCTCATAGCAC
G2-B1 GGGCCTAGTCCTGCTGGTC CAAAGAGTGCGGAGAAATGG
G2-B8 CAACATGCGACCACTATAGCCACTTCCT CGCCACCGCCACCACCACA
G2-C2 TTTGCAGGAAGAGTCATAACACAG GTCAACAACACCCTTTTCCCTTCCT
G2-D1 GCAGGTCGGCAAGAAGCTAAAGAAGGAA AGGGTTGGTTTGAAAGGATGTGCTGGTAA
G2-E17 GGAGCACCAAATTCAAGTCAG CGTCCCCGGTCAATCTCCAC
G2-E19 CCAGTTTGAGCCCCAGGAG TCGCGGCAGTCAAGAGGTC
G2-F17 TATCCTCTTATTGCTGCATTCTCCTCAC AGTACGGCCGTTCACCATCTCTG
G2-F2 CACACCACAGACGCATTGAC TCCCCAGCCTGTGTAGAAC
G2-G13 GGGAGGGGAGAAGGCTACCA ATACACGGCTTCCATGCTTCTTCTT
G2-G15 CCACGGCCCCACATCCAGC TCCCGCAGAATTTCCGTATCCAT
G2-G21 TCCAAGAGGGTGTGAGGTGAAC AAAGCCATGCGAAGCGGAAGAC
G2-G23 GGTTTGGTACTTCAGCGGATGT CCAAAGCCTGTACTATGCGAAAAG
G2-G5 CGGTCCCTACTGTGGTCTATGGTTTTCA GGCTCTGCATATCCTCGGTCACACTTCC
G2-G6 CCCATGGCTGCAAGGATTACG CAGGGGTTGTTGGGAGGCAGTGT
G2-H18 TTGTCAAATGGGCGAGTTCA TGTTTTGCACCCAGTTTTTG
G2-I18 GATCTCCTCAGGTCTCTTTCA GATTATGGGCCGGTGTCTCT
G2-I23 TGACTTTCCCAATGTGAGCAGAC CAGAGGTGGTGTTACAGCAGCAGTTT
G2-J12 CCTCTTGTCCCAGTGCCAGTG TCCAGGGATCCGAAACAAAG
G2-J21 CCGCCTCAGCCTGTTTCTCTACTTTT CTTTGAATTTCTGCTTTTGGTGCTCTGC
G2-K12 ACATTAGTCCTGGTTACGAGAGC AAAGGGCAGTCCAGCATTGA
G2-K2 CTGCCCAAGAAGACCGAGAGCCACAAG AGCGCCCCCTGCACCAAAATCA
G2-L16 CCAAGGGTAGGAGAACAAGACA ATGGCATGCTGGGAAATCA
G2-L21 GAATCTAGGTCCAAGCAGTCCCATCT GACCATCACACCACTACCCACACTCA
G2-L3 TGAAAGAGGCCAGAAACAAGTAG TTCCCAAGGTCTCCATAACAAT
G2-L4 TGGCCAAGAAGATGAAACAGGAAGAGGAG TGGCAAAGGACACGACGCAGAG
G2-M14 CGGCCTCCTCGACGCATACG CCAGGCCGGCCCATTGTTC
G2-M24 ACGGAGCACGGTCAGATTTCACG CCCGGCTGGCTCTTCTTGCTCTT
G2-M3 CGATCCGCATTGAACGAGT TGTGGCAGGAAGGAGAAGG
G2-N2 CGTGTTTTCCTCCTATGTCGACTTCTTTG ACGTGCTCTGCCTTTCTTGATCTTGTGTT
G3-D7 AGGATTTCTTGGCCGGTGGAGTGG GAAGTTGAGGGCCTGGGTGGGGAAGTA
NT001D_E08.5.1 AGAAGTTCCTAGATGAGTTGGAGGAG AATTAATTTCCTAAACCAGGTGACAG
NT010B_E09.5.1 GAAGAGGTCCTAAAATATCAAGATGC ATGATAGACTTCGTCCTTGTCATAGA
NT014D_E01.5.1 AAAGAAGTCCCGCATCTAACCT ATTAAATATGAGAAGATGTGTGCAGG
V2_p1_b8 AGTCACTGTGTTACATTATCACCCAC ATAATTATACACTGCGGTCTGCATCT
V2_p1_c5 AGTACCTGTTCGACAAGCACAC TGAGAACATAGACAAGTTAACATACACC
V2_p1_d10 GAGATAGAAAGGCTGCATAAAGAAAT TATGTTTCAACAATGTACAGGAAACC
V2_p1_d4 CACCAGAACAAGCTGTATTTTTATGT TGGTTTGCATCATATATTAAAGGGTA
V2_p1_g7 GACTTCAAGCACATTGGGAAAC ATTGTAAACTTGATAGGCTGGTGAG
V2_p2_g6 AGAATTCCCAATAGCACCTGAAAT CACTTGGTAAATACATACACACAGCA
V2_p2_h2 CTTTTTGGCCTGGTCTTTTTG AGATTCTTCAGACTCGTCCTTCTTT
V2_p3_a5 TTTACACAGAAACCTTGTTTATTTGGC TTTAAGGATGCTTAGAGGCAAAGTATT
V2_p3_b1 AGTCACTGTGTTACATTATCACCCAC TATACACTGCGGTCTGCATCTACT
V2_p5_b3 AATGGGATGAAGAGCGAGAAT CTGCCCCATTGACATTTACCTA
V2_p5_h3 CCTTCAGACGAAAACAGCACTAAG TACAGTGTATGAGAGCCCAATATTTC
V2_p6_a4 AGAAATACATCAAATATCGGGTGG AAAAAGGACAATGTTCAGCTCTCT
V3_p1_a21 ACCAAGTTCTTGGAAAGTGGTG CTTAGTGTCTCCTGGGTTTGAATAG
V3_p1_b13 GTCTTGGTACTCAATGAAGGAGATG TCAATCTGATGAAGAGTTTACATGTCT