Skip to main content

Table 5 Primers used to amplify short fragments of the Squilla mantis genome. Majority/minority strand are with reference to the ancestral pancrustacean sequence. These primers will work for almost all arthropods and for many other metazoans as well. Reference "JB" is J. Boore pers. comm. Reference "CEC" refers to primers designed for this project.

From: The complete mitochondrial genome of the stomatopod crustacean Squilla mantis

Gene Majority strand Sequence Minority strand Sequence Reference
COX1 Lco1490 GGTCAACAAATCATAAAGATATTGG Hco2198 TAAACTTCAGGGTGACCAAAAAATCA 38
COX1-COX2 CO1DL CCWCGWCGWTAYTCWGAYTAYCCWGA CO2DL CWGAATARRCATAWSWTCARTATCATTG JB
ATP6-COX3 ATP6.AANMM GCCGTACGGCTTGCAGCNAAYATRAT CO3DL2 ACWACGTCKACGAAGTGTCARTATCA CEC, JB
COX3 CO3DL1 TGGTGGCGAGATGTKKTNCGNGA CO3DL2 ACWACGTCKACGAAGTGTCARTATCA JB
ND5 ND5-R-DL TARAAKCCWGMTARAAAWGGKAWWCC ND5-F-DL TWYTATTAGGKTGAGATGGKYTNGG JB
ND4 ND4-R_DL GARGAWCAKAWWCCRTGAGCAATYAT ND4-F-DL CCKAARGCYCAYGTKGARGCYCC JB
CYTB Cytb424-449 GGWTAYGTWYTWCCWTGRGGWCARAT Cytb876-847 GCRTAWGCRAAWARRAARTAYCAYTCWGG JB
ND1 ND1DL1 CCTTCWGCAAAATCGAAAGGGGYHCG ND1.YIQIR AAGATCCTTGGATAYATYCARATYCG JB, CEC
ssrRNA 12Sb-3' GAGGGTGACGGGCGGTGTGT 12sa-5' AAACTGGGATTAGATACCCTATTAT JB
lsrRNA 16SBRH CCGGTCTGAACTCAGATCACGT 16SARL CGCCTGTTTATCAAAAACAT 39