Skip to main content

Advertisement

Table 1 ASAP PCR primers. Primer sequences, annealing site and the relative position in tobacco (Nt), Arabidopsis (At) and maize (Zm) are presented, along with the anticipated amplicon size. * represent the primers with low sequence similarity in maize.

From: ASAP: Amplification, sequencing & annotation of plastomes

Primer Gene (Nicotiana) Sequence 5' to 3' Position in Nt Size Position in At Size Position in Zm Size
IRB1F Upstream of JLB ggatttttttttagtgaacgtgtcac 86657–86682 804 84258–84283 812 82644–82669* 1001
IRB1R Intron rpl2 aagtatcgacgtaatttcatagagtc 87436–87461   85045–85070   83622–83647  
IRB2F Intron rpl2 catctggcttatgttcttcatgtagc 87397–87422 1048 85006–85031 1049 83583–83608 1043
IRB2R rpl23 3'end caactaggacagaaataaagcattgg 88420–88445   86030–86055   84601–84626  
IRB3F rpl23 3'end atacgtctgtaatgcattgtatgtcc 88310–88335 1001 85920–85945 980 84491–84516  
IRB3R YCF2/ORF2280 5' gaagatacaggagcgaaacaatcaac 89285–89311   86875–86900   Deleted  
IRB4F YCF2/ORF2280 aagaaaaaatctctatttgatagggc 89181–89206 1031 86770–86795 1037 Deleted  
IRB4R YCF2/ORF2280 tttcgttccgtttgaagaaaggaagg 90212–90187   87782–87807   Deleted  
IRB5F YCF2/ORF2280 ggattccattagtaatgaggattcgg 90096–90121 1162 87685–87710 1171 Deleted  
IRB5R YCF2/ORF2280 gaggctcgaaccatttcttctgactc 91233–91258   88831–88856   Deleted  
IRB6F YCF2/ORF2280 cttcgaatatggaattcaaagggatc 91131–91156 1042 88729–88754 1081 Deleted  
IRB6R YCF2/ORF2280 tgaatatgttagatacctgtgactcg 92148–92173   89785–89810   Deleted  
IRB7F YCF2/ORF2280 acaattcctcaatatcttgttcattc 92049–92074 1091 89680–89705 1088 Deleted  
IRB7R YCF2/ORF2280 tcttctagagaatctcctaattgttc 93115–93140   90743–90768   Deleted  
IRB8F YCF2/ORF2280 gaaaaggtcaaatctttgatgattcc 92995–93020 1041 90623–90648 1035 Deleted  
IRB8R YCF2/ORF2280 tttccggcatcatatccatagttagc 94011–94036   91633–91658   Deleted  
IRB9F YCF2/ORF2280 ctgaacaagttcctggataacaagcc 93853–93878 1169 91493–91518 1151 Deleted  
IRB9R YCF2/ORF2280 aaatctctgatcaaggatagaacaag 94997–95022   92619–92644   Deleted  
IRB10F YCF2/ORF2280 gatctagttcatggcctattagaagt 94849–94874 1025 92471–92496 1021 86077–86102 1138
IRB10R ORF 87/YCF 15 taacatattcttccatggagctaagg 93849–95874   93475–93492   87190–87215*  
IRB11F YCF2/ORF2280 3' cggatgaaatgaaaattggattcatg 95669–95724 1094 93330–93355 1319 No similarity  
IRB11R ORF 79 aatcggacctgctttttacatatctc 96739–96763   94624–94649   No similarity  
IRB12F ORF 79 ccaattgcttcgatttgaattatccg 96626–96644 1061 94483–94508 1101 88794–88819 1079
IRB12R ndhB 3' exon tggaaatcctagctattcttagcatg 97662–97687   95559–95584   89848–89873  
IRB13F ndhB 3' exon attccaataattacatatccgatttg 97567–97592 1043 95464–95489 1049 89753–89778 1068
IRB13R ndhB 5' exon cttatcaatacacaaatgtataactc 98585–98610   96488–96513   90796–90821  
IRB14F ndhB 5' exon tacgtcaggagtccattgatgagaag 98494–98519 1171 96397–96422 1206 90705–90730 1192
IRB14R rps 7 5'end aatatggctttcaaattaagttccga 99640–99665   97578–97603   91872–91897  
IRB15F rps 7 5'end gtgcaaaagctctatttgcctctgcc 99551–99576 1230 97489–97514 1231 91783–91808 1245
IRB15R rps12 exon 2 tcactgcttatatacccggtattggc 100754–100781   98695–98720   93003–93028  
IRB16F rps12 exon 2 tcctcgaacaatgtgatatctcacac 100699–100694 968 98608–98633 1079 92916–92941 859
IRB16R Spacer caacataggtcatcgaaaggatctcg 101642–101667   99662–99687   93750–93775  
IRB17F Spacer gtgtgagcttatccatgcggttatgc 101554–101581 1116 99576–99601 1345 93669–93694 1339
IRB17R rrn16 start gcttcatattcgcccggagttcgctc 102645–102670   100896–100921   95043–95068*  
IRB18F trnV 3' end aagtcatcagttcgagcctgattatc 102504–102529 1117 100751–100776 1122 94901–94926 1121
IRB18R rrn16 start tgagtttcattcttgcgaacgtactc 103596–103621   101848–101873   95997–96022  
IRB19F rrn16 cgacactgacactgagagacgaaagc 103452–103477 1343 101704–101729 1341 95853–95878 1347
IRB19R trnI Intron/OriA atcgaaagttggatctacattggatc 104770–104795   103020–103045   97175–97200  
IRB20F trnI start gggctattagctcagtggtagagcgc 104551–104576 877 102801–102826 898 96953–96978 1119
IRB20R trnA start caagagcggagctctaccaactgagc 105403–105428   103674–103699   98047–98072  
IRB21F trnI end gaggtctctggttcaagtccaggatg 105229–105324 941 103571–103596 962 97943–97968 968
IRB21R trnA end ataagcggactcgaaccgctgacatc 106145–106170   104508–104533   98886–98911  
IRB22F trnA intron agattttgagaagagttgctctttgg 106003–106028 1190 104367–104392 1188 98743–98768 1193
IRB22R 23S tagatgtccagtcaactgctgcgcct 107168–107193   105530–105555   99911–99936  
IRB23F 23S gaaactaagtggaggtccgaaccgac 107053–107079 1225 105416–105441 1224 99797–99822 1291
IRB23R 23S cgctaccttaggaccgttatagttac 108253–108278   106615–106640   101063–101088  
IRB24F 23S ggtctccgcaaagtcgtaagaccatg 108131–108156 1172 106493–106518 1169 100941–100966 1156
IRB24R 4.5S acatcactgcacttccacttgacacc 109278–109303   107637–107662   102072–102097  
IRB25F 23S end ctgctgaaagcatctaagtagtaagc 109089–109115 963 107451–107476 929 101897–101922 920
IRB25R trnR end ggttgtgggcgaggagggattcgaac 110027–110052   108355–108380   102792–102817  
IRB26F Spacer aaatggctggggagaggaaaggttcc 109905–109930 1182 108231–108256 1232 No similarity  
IRB26R ORF350 attatcttcatgcataaggatactag 111062–111087   109438–109463   No similarity  
IRB27F Spacer tggctctatttcattatattccatcc 110844–110869 1036 109225–109250 986 No similarity  
IRB27R ORF 350 agtggatccctcttgttcctgtttag 111855–111880   110186–110211   No similarity