Skip to main content

Table 3 Primers used for RT-PCR amplification of cDNA fragments of FBXO12B, FBXO12D, Tcl1b3, Tcl1b4, Tcl1, SpeerA, AK076711, Oosp3 and actin.

From: Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

Gene Primers annealing temperature fragment size (pb)
FBXO12B Upper ATTTGCCTCGTTTGCCTCTGA 49°C 890 pb
  Lower GGTTATCCTGTCTTCCCTTCT   
FBXO12D Upper AGCCCTGTCCTTTTCCTGTCA 50°C 491 pb
  Lower AATAGTCTGGTTTCCCCTCAC   
Tcl1b3 Upper TGGTAGACAGTGGGTAGTTGC 54°C 585 pb
  Lower CAGGTGGAGGAGTTTGAATGG   
Tcl1b4 Upper TAAGAAGGCAGCCAACCAGAC 54°C 838 pb
  Lower CTACCCAGCACCAGGCGAACT   
Tcl1 Upper TTTTATCACGGACTGGCATTG 54°C 1208 pb
  Lower CCCTCATTTATTGGCATCTCG   
SpeerA Upper TGAAGCAGGAAAATAGGAGA 51°C 900 pb
  Lower CCAAACAGAAAACCAAACAC   
AK076711 Upper GGCTCCCAGAGGCTGAATCA 61°C 769 pb
  Lower TAAGGGTGTCCAAAGAATCA   
Oosp3 Upper TATTTGGGATGTGGAGATGTT 52°C 416 pb
  Lower TTGAGGAGGAGGGTGGAAGTC   
Actin Upper ACGGAACCACAGTTTATCATC 60°C 180 pb
  Lower GTCCCAGTCTTCAACTATACC