Skip to main content

Table 1 Sequence and localization of the primers employed for the isolation ofthe midgut aminopeptidases from S. exigua by RACE experiments

From: Bacillus thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one of four Aminopeptidase N genes

Gene name Primer sequence (5' to 3') Position in ORF
APN1 3'Race TGCGCTTCGAAGATTGGCTCACGATA 2018–2044
  5'Race CTTCGATGAATGCCGAGACGCTGGAC 2122–2097
APN2 3'Race CTTTGCTGCTGGTGCTATGGAGAACTGG 906–932
  5'Race ACAGGGCTGACTTCATTTCCGAACCATT 1067–1040
APN3 3'Race ATGCGTGAYGAYATGTACGGTAT 496–518
  5'Race GCCAGGAGATAAGTTGACATTTTTGGGG 779–752
APN4 3'Race TGGCTTTCCATGTGAGCGATTTTGTGC 728–754
  5'Race CACACCGATTTCTGCAGCATACGAGTGC 849–822