Skip to main content

Table 3 Sequence of the probes used to detect KIAA0676 protein and their location on the arrays.

From: Identical probes on different high-density oligonucleotide microarrays can produce different measurements of gene expression

  Probe sequences for KIAA0676 protein Plus chip location A chip location   Probe sequences for KIAA0676 protein Plus chip location A chip location  
  206431_x_at X Y X Y   215994_x_at X Y X Y  
1 ACACTTAGTCCTCCACAGTGGGTGG 360 191 527 107   CAAGTATGGGGCCCTGGCTGTGTTC 765 297 4 169  
2 AAGAGTGCAAGGTCTGCCAGGTCAG 669 255 593 145 GTTCAAGACACTTAGTCCTCCACAG 373 707 157 437
3 CAGAACCTGCTGGTGCAAGCTGGGC 1105 327 588 189 CAGAACCTGCTGGTGCAAGCTGGGC 1104 327 586 189
4 TGGGCAGGTCCTGACCAACCTGCAT 924 913 60 565 TGGGCAGGTCCTGACCAACCTGCAT 923 913 58 565
5 CACAGGTCTTCATGGGCAGGGGTTG 586 309 333 175 CACAGGTCTTCATGGGCAGGGGTTG 585 309 331 175
6 ATCCTCAGGCCTGGGCTGTAGCAAG 179 51 419 29 ATCCTCAGGCCTGGGCTGTAGCAAG 178 51 417 29
7 GCTGTCTGCCCTTGGGTTCAAGAAC 85 499 180 309 GCTGTCTGCCCTTGGGTTCAAGAAC 84 499 178 309
8 ACAAGGATACCCTCACTTTGCATGA 814 193 566 111 ACAAGGATACCCTCACTTTGCATGA 813 193 564 111
9 TTAGCCCCCACATGGGGCTGCTCTT 921 1117 380 687 CTGACCAGTGTCCAGTGTTAGCTCC 840 395 141 235  
10 GGCTGCTCTTGCTTCTACTAAAAGA 557 883 207 545 GGCTGCTCTTGCTTCTACTAAAAGA 558 883 205 545
11 TAAAACCAGACCCCCAGTGGATGTC 87 1045 596 645 TAAAACCAGACCCCCAGTGGATGTC 86 1045 594 645
  212054_x_at       212052 _s_at      
1 GTTCAAGACACTTAGTCCTCCACAG 372 707 158 437 GCTGCCTTAGACAGATTCCCTGGGC 1122 503 45 313  
2 AAGAGTGCAAGGTCTGCCAGGTCAG 668 255 592 145 CACCTTCCTTACACCTGGTGGGAGC 694 319 337 181  
3 CAGAACCTGCTGGTGCAAGCTGGGC 1103 327 587 189 TATGTGGTATGGGGGTCATTCCTGC 491 1077 179 663  
4 TGGGCAGGTCCTGACCAACCTGCAT 922 913 59 565 AAGTGATGGAACCCTCAGGTGCTCT 403 263 599 147  
5 CACAGGTCTTCATGGGCAGGGGTTG 587 309 332 175 AGCCTGAACCTCCTGACTGAGGAAC 888 143 235 81  
6 ATCCTCAGGCCTGGGCTGTAGCAAG 180 51 418 29 CACAGGCGTGGCTGTACACGTGCTC 157 311 554 177  
7 GCTGTCTGCCCTTGGGTTCAAGAAC 83 499 179 309 CTCATCATCCTTTCCAGTAACTTTA 714 379 680 221  
8 ACAAGGATACCCTCACTTTGCATGA 815 193 565 111 AAAAAACATCCCTCAGGTCCTGATA 916 219 212 123  
9 TTAGCCCCCACATGGGGCTGCTCTT 922 1117 379 687 GGTCCTGATATATTTCCTTGGATTC 1147 821 183 507  
10 GGCTGCTCTTGCTTCTACTAAAAGA 556 883 206 545 TTGGCTAGAAATTACACTGTGCTCA 1041 1161 505 709  
11 TAAAACCAGACCCCCAGTGGATGTC 85 1045 595 645 TGTGCTCAATGCCTTAATAAATCCC 842 919 38 569  
  1. √ indicates that the probe is identical to another probe in this group of probesets.