Skip to main content

Table 1 Primers used for standard RT-PCR

From: Tissue-specific expression of TRP channel genes in the mouse and its variation in three different mouse strains

Gene Accession number, product size & references Sequence 5'-3'
TRPC1 NM_011643
371 bp [11]
for: CAAGAT TTTGGGAAATTTCTGG
rev: TTTATCCTCATGATTTGCTAT
TRPC2 NM_011644
326 bp [29]
for: GATCCGGTTCATGTTCATCCT
rev: GAGCGAGCAAACTTCCACTC
TRPC3 NM_019510
317 bp [11]
for: TGACTTCCGTTGTGCTCAAATATG
rev: CCTTCTGAAGCCTTCTCCTTCTGC
TRPC4 NM_016984
414 bp [11]
for: TCTGCAGATATCTCTGGGAAGGATGC
rev: AAGCTTTGTTCGAGCAAATTTCCATTC
TRPC5 NM_009428
339 bp [11]
for: ATCTACTGCCTAGTACTACTGGCT
rev: CAGCATGATCGGCAATGAGCTG
TRPC6 NM_013838
326 bp [11]
for: AAAGATATCTTCAAATTCATGGTC
rev: CACGTCCGCATCATCCTCAATTTC
TRPC7 NM_012035
692 bp
for: CGTGCTGTATGGGGTTTATAATG
rev: GCTTTGGAATGCTGTTAGAC
TRPV1 NM_001001445
320 bp
for: GCATCTTCTACTTCAACTTCTTCGTC
rev: CCACATACTCCTTGCGATGGC
TRPV2 NM_011706
427 bp
for: CGGCACTTCCTCTCT
rev: GTCGGTCACGGTCAA
TRPV3 NM_145099
298 bp
for: CAAGGACTGCCACCACCATC
rev: CATCACAGTTGCCAGAGAGG
TRPV4 NM_022017
249 bp
for: GAGTCCTCAGTAGTGCCTGG
rev: CAACAAGAAGGAGAGCAGTC
TRPV5 NM_001007572
172 bp [30]
for: CGTTGGTTCTTACGGGTTGAA
rev: GTTTGGAGAACCACAGAGCCTCTA
TRPV6 NM_022413
318 bp
for: AACCAGCCTTCCACC
rev: CCTCCATTAGCACCA
TRPM1 NM_018752
446 bp
for: TATCCTATGACACCAAGCCA
rev: GGTCTTCCTTATTCTCCACG
TRPM2 NM_138301
215 bp
for: CAGATCCCAACCTACATTGACG
rev: GAAGGTGTAGTTGAACATGGCGA
TRPM3 NM_177341
497 bp
for: CCTGTTCTTCTGGCA
rev: GCTTCTCTGGCTCCT
TRPM4 NM_175130
176 bp
for: CCCTGAGGATGGTGTTGAGT
rev: AGGAGCACTGGGATGTCAAT
TRPM5 NM_020277
360 bp
for: CAGATACTGAGGATGGCTGG
rev: GGATCTTGGTGGATGTGCTA
TRPM6 NM_153417
219 bp
for: CCAGGTGCCGGTAATAACA
rev: CTCTTGTGGCTGCCTTAGGT
TRPM7 NM_021450
295 bp
for: CGGAGCTGGTCGCACAATTA
rev: CCTGGAAGACATCTGTGAGG
TRPM8 NM_134252
344 bp
for: TCCACGAGACTTCTTCACTT
rev: GTGTATCTGAGGTCAGTCTT
GAPDH NM_008084
451 bp
for: ACCACAGTCCATGCCATCAC
rev: TCCACCACCCTGTTGCTGTA
  1. Primers described in the literature are indicated (references). All other primers were newly designed.