Skip to main content

Table 5 Primer sequences

From: Epigenetics of gene expression in human hepatoma cells: expression profiling the response to inhibition of DNA methylation and histone deacetylation

Primers Sequences
HE1741 CCAGGGATTAGGAGTGGACC
HE1742 GGAGGGGAAGAGCAGTTGTC
HE2251 GATTGGACCTCATTACATAAGGG
HE2252 TCTTTTGGGGTTAGCAAGTTG
HE2261 AGGGTTGTGTGAAGACAGCG
HE2262 TTGTTGCGGTGGTGGGGAAAG
HE2245 GGACCCTCAGCCTTGTTTG
HE2246 AACCCCCCTCACCTCATTGG
HE2255 TGTCCAAACCAACCGCAC
HE2256 AACAGCAACAAGCCCGTAG
HE2253 CCTGATGTCCAGCAGAAAGTGC
HE2254 GTTAGAAGAAGTCCTCCAAAGCG
HE2219 TACCAGTCCAATACCATCCTGCG
HE2220 TGCCTTCACATAGTCATCCTTGC
HE2241 ACTGGTTGGAGTTGTGGAGACG
HE2242 TGGAATGCTTGAAGGCTGCTC
HE2369 AATCAAAACACCGCACCAG
HE2370 ATCAGTGAGGGGCAAGGGGGGTTC
HE2243 CAGACGGAACCTCAGATTTGCC
HE2244 CAGTGCGATTTGGAAGTAACCTG
HE2265 GCAAAGAGGGTGACAAGTTCAAGC
HE2266 GCCAGGGTGGAAAAAAAAAAGTGC
HE2249 CTCTGACCACAACTTCGCAG
HE2250 CCACATTTACCCCCTCTTCC
HE3106 CTACCCCGAGGAGAAGAAAGAG
HE3107 CTGTGTTCAGAGAAGGAATCGTC