Skip to main content

Table 2 Sequences of PtMKKs " 3'RACE and RTqPCR primers used for 3'UTR MAPKK gene isolation and expression profiling.

From: MAP-ping genomic organization and organ-specific expression profiles of poplar MAP kinases and MAP kinase kinases

Group Gene name 3' RACE Primers (5' to 3') Forward RTqPCR Primers (5' to 3') Reverse RTqPCR Primers (5' to 3')
A PtMKK2-1 TGGTATTGCTGGAGTGTGCAACAGGCCA TGCAAATGCATCAAACTCCTG CCACCCAAAAGAGACATCAG
  PtMKK2-2 CTCCACCTTCTGCACCACCAGACCAATT AGCTTGCAAACTATGAGGAAC CGATTCTGTCAGGGAAAACC
  PtMKK6 GCTGCAACCCTCCAGCTCAGGTCCC GGGAAGGTTGTCATCTTTGG TGGGTAATTCACAGGAGGTTC
B PtMKK3 GCAGTTGCAATCCGCGTTTCAGGATCC GCTCTATGTTCCTCCAGTTAC GAAATGGTTTCATATCTGTCACG
C PtMKK4 ATTGCTTGTTGTTTGCAGAGGGAGCCGG GAATTGTTGTGGGTTATTGTTG GGTCAGAACTAAAGGTGCTGTG
  PtMKK5 CCCAATAACCGCATCACTGTCGATGAGG AGCATCCGTTTATTGTGAGAAG AACTACCTACTAAGCAATTGGC
D PtMKK7 CGAGCTTGCCGGAGGGAGCATCTGAGGA TGACCCGAATGCCCAGTTAA TTCCTCTCATTTCAAGAGCAG
  PtMKK9 GCGTCGGAGGAGTTTCGGGACTTTATTC ACTTTATTCAGTGTTGCCTGC GGGTCAAATCACAAGTCCAC
  PtMKK10 TGTGGAGAGAAACCAGACTGGGCAGCAT TTTGGTCTGGATATAAGCTGTG TGCAAAACCAGCATCATCTTC
  PtMKK11-1 GGGAGTGCTCTGCAGTTGTTGCAACACC TGCAACACCCTTTTATACTGC TGATGGAAGTGACAGGATGG
  PtMKK11-2 GGAGAATCCCCTAGCTTCCCAAAGGAAG CCTATGTTTGCTTAGGGGAG TTGGTCCAAGAGCCATTTCG