Skip to main content

Table 1 Multiplex PCR primer pairs

From: TAMGeS: a Three-Array Method for Genotyping of SNPs by a dual-colour approach

SNPs SEQUENCE (FORWARD and REVERSE) μM PRODUCT LENGTH
rs3738701 5'- ACCTGAGAGGGCAAGTCAGAACCAACT -3'
5'- CGAGGTCCTGTGTTCGGCAACTTTA -3'
0.16
0.16
197
rs11466112 5'- CAAAGCACTGGAACTCATATTGTACCACG -3'
5'- AATAATTTACAGGTTGAGGTAGGGAGGGG -3'
0.32
0.32
221
X60202 5'- TAATGAGACACCCACCGCTGCTGTG -3'
5'- TCTACCGGAGGGGAGGAAAGAAGGAGAC -3'
1.60
1.60
262
rs741072
rs734194
5'- GAAGCATCGGAGGGAATTGAGGTCTG -3'
5'- GCCAAGCTCAGGAAAAAACAGTCCTTTG -3'
0.28
0.28
301
rs2289656
rs2289658
5'- TGCCTAACAAATGAGATGGATGTCTTTCCT -3'
5'- GAACCCTCCACTCCTGAACCCTGAA -3'
0.24
0.40
325
rs6336
rs6339
rs1799770
5'- TGCCTCTACTGTTCTCTCAATCCTCCACTT -3'
5'- CCTGCTCATGCCAAAATCACCAATCTT -3'
0.24
0.24
352
rs6265
rs3750934
rs8192466
5'- GGGGAAACACTGCATGTCTCTGGTTTATAT -3'
5'- GACTACTGAGCATCACCCTGGACGTGTAC -3'
0.24
0.24
530
rs2275857 5'- AACCACCCTCCCTTCCTTTCTCTAGGTCTA -3'
5'- AACCCTTCTTACCTTTCATGCCAAACTTG -3'
0.16
0.16
136
rs1047856 5'- GCTTCAGTGGTTCTATAACGGGGCAATAT -3'
5'- CTCATCCTTCCCATACTCATTCTTGGCTATT -3'
0.32
0.32
171
rs3753213 5'- CACCGCCTAGTCCCTTGGTTCTGAC -3'
5'- GTGGCTGCACTAACCCATCCGTCTC -3'
1.44
1.44
291
rs1800878 5'- GCATGTGCATGTGTATTGTGAGGGAGTAAG -3'
5'- CTCAAAGCCCTGAGCTTCCTGACTTCTC -3'
0.32
0.32
328
rs2072446
rs2072445
5'- GCCAGAGTCACCCAGCAAGTCAGTG -3'
5'- CCGTGCTGGCTATGAGGTCTTGTTCT -3'
0.16
0.16
347
rs6330
rs11466110
rs11466111
5'- TGCATAGCGTAATGTCCATGTTGTTCTACA -3'
5'- GATGATGACCGCTTGCTCCTGTGAGTC -3'
0.32
0.32
382
rs1048218
rs1048220
rs1048221
5'- AAGAGGCTTGACATCATTGGCTGACACT -3'
5'- CATGGGATTGCACTTGGTCTCGTAGA -3'
0.32
0.32
410
  1. Primer pairs are subdivided according to the PCR multiplex mix (each performed with 7 primer pairs) in which they were used. For each pair, there are indicated the SNPs comprised in the corresponding amplified fragment, the primer sequence of the primers (forward and reverse), the concentration employed in the reaction and the length (in bp) of the corresponding amplified fragment.