Skip to main content

Table 3 Primers used in RT-qPCR.

From: Large-scale copy number variants (CNVs): Distribution in normal subjects and FISH/real-time qPCR analysis

Cytoband Clone name Primer name Forward primer (5'-3') Reverse Primer (5'-3')
2q37.3 RP5-1011O17 RP5-1011O17-A
RP5-1011O17-B
RP5-1011O17-C
AAATGGTGACTCTTGTGAATTTGGT
GGGAAGGTGGGTGGCTACA
ACACTGATGAAGGTTTTCCTTGTG
GGGAAGCTGTGGCCAAAA
CAAGCAGGCCTTGGTAACACA
GGCAGCACTGAACTACAGCAGTT
13q21.1 RP11-100C24 RP11-100C24-A
RP11-100C24-B
RP11-100C24-C
CCACCTCCCAACTCTGTGTGT
CTGCTTTATGGTGCCTTTTGC
TGTTTTGGCTTTCTGGCAGTT
CCCTCCAGAGATAGCACGTTCT
GTCAGAGAGGACTGCGGAAACT
CAAAGGCAGGAGGCTGTTCT
8p22 RP11-89M16 RP11-89M16-A
RP11-89M16-B
RP11-89M16-C
TTCCCAGCTCGTGCTCTCA
TGGATGGTGCTAGAGAGGTAGATG
CAGGATCACCCAAGGCAGTAA
CAGTGGAAGGCTCTTCATGCT
TGCAGGAATGTGCTGGTTTG
TCTAAACTCCCTTTTTGAGGCATT