Skip to main content

Advertisement

Table 8 Potential melon miRNAs

From: MELOGEN: an EST database for melon functional genomics

Name Potential mature miRNA sequence (5'->3')* Melogen unigene Precursor folding free energy (kcal mol-1)§ MFEI (kcal mol-1)Δ miRNA family Potential target in melon
m2 ugaagcugccagcaugaucu bCL2353Contig1 -206.8 -0.67 miR167 --
m4 ugauugagccgugccaauauc bPSI_40-F10-M13R_c -195.0 -0.66 miR171 bHS_39-C12-M13R_c
m7 ucggaccaggcuucauucccc bA_31-D02-M13R_c -160.8 -0.70 miR166 --
m8 uugacagaagauagagagcac bCI_04-H02-M13R_c -188.2 -0.74 miR157 bCI_30-A09-M13R_c
m12 uuggacugaagggagcucccu b15d_24-H05-M13R_c -163.6 -0.86 miR319 bCL2243Contig1
  1. *Nucleotide sequences correspond to potential mature miRNA sequences as deduced from BLAST searches using known plant miRNA sequences [54] and analysis of secondary structure predictions [52]. Accession numbers (MELOGEN database) of potential precursors of melon miRNAs are given. §Computational values of folding free energies have been calculated using MFOLD 3.1 [55]. ΔMinimal folding free energy indexes (MFEIs) have been calculated as described by Zhang et al. [53].