Skip to main content

Table 1 Primers used to detect equine polymorphisms

From: Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

Gene Region Forward Primer Reverse Primer
OAS1 Promoter AACCCACAGAATAAACACCACA GTCGATGGCTTCTCGGAC
  Exon 1 CCAGACTCAGGCAACGTAAG GTTTTGCTCTCTCCCTTCCT
  Exon 2 GTGATTGTTGTCTGGTGATGG AAACTGTGGGAGATTTCTGCT
  Exon 3 GTAACTTGGTTGTGTCCGTGG AGACTGGATGGAGGGCCATA
  Exon 4 AGCGTGAAAACCACCACAGA TCCCACATCCTCCATTTCC
  Exon 5 CACTGGGCTGGTCCTCCT CCTCCAAACGGGGTCAAA
  Exon 6 GCAGGTGGCACGTCACAG GGCACTGTGCCCTGAAGTTAA
RNASEL Exon 1 CATCTCCCTTCTCCGTCCTCG TGCAATGGATGAGTCCTGGT
  Exon 2 CAAAGTACTTCTCTCATCCCCAG TCCGAAGAGCATGGAACAAA
  Exon 2 AAGATCCTCCTTGATGAGATGG GGCCTTTCCTATCTGCAATG
  Exon 3 AAATGTAAGTCCTGCTCTTGGC CAAGCAACTCCACACCAACC
  Exon 4 CTCGTAGCCTGCACCACAC CACGGTAGATCGCGGAACTT
  Exon 5 CCATGTTAATTCTCTCATCTTCAG TCTCTCACCTCTTGGTAGGGC
  Exon 6 GCTCCTACATTTTTGCGTAATG GTTCTTCCCATCAAATAGCAGA
  Exon 7 ATCTCTGGAACCGGGTGCT CACTACCAAATGGCCCTGAG
  Exon 7 CTCTGGGTGGCTCATTCATT TCCCAGCTCTTCCCATTACA
  1. Forward and reverse primers for amplification of the OAS1 promoter and individual exons of equine OAS1 and RNASEL.