Skip to main content

Table 7 Sequence and positions of primers used to amplify and/or sequence the mtDNA genomes of chimpanzee and gorilla

From: Interspecies hybridization on DNA resequencing microarrays: efficiency of sequence recovery and accuracy of SNP detection in human, ape, and codfish mitochondrial DNA genomes sequenced on a human-specific MitoChip

Primer Sequence (5'-> 3') PCR 5' Pos
h01 F: CTCCTCAAAGCAATACACTG
R: TGCTAAATCCACCTTCGACC
x 1
839
h02 F: CGATCAACCTCACCACCTCT
R: TGGACAACCAGCTATCACCA
  635
1 435
h03 F: GACTAACCCCTATACCTTCTGC
R: GGCAGGTCAATTTCACTGGT
  1 240
2 097
h04 F: AAATCTTACCCCGCCTGTTT
R: AGGAATGCCATTGCGATTAG
  1 889
2 773
h05 F: TACTTCACAAAGCGCCTTCC
R: ATGAAGAATAGGGCGAGGG
  2 558
3 388
h06 F: TGGCTCCTTTAACCTCTCCA
R: AAGGATTATGGATGCGGTTG
x
x
3 185
4 087
h07 F: ACTAATTAATCCCCTGGCCC
R: CCTGGGGTGGGTTTTGTATG
  3 874
4 851
h08 F: CTAACCGGCTTTTTGCCC
R: ACCTAGAAGGTTGCCTGGCT
  4 646
5 458
h09 F: GAGGCCTAACCCCTGTCTTT
R: ATTCCGAAGCCTGGTAGGAT
x
x
5 243
6 069
h10 F: CTCTTCGTCTGATCCGTCCT
R: AGCGAAGGCTTCTCAAATCA
x
x
5 858
6 742
h11 F: ACGCCAAAATCCATTTCACT
R: CGGGAATTGCATCTGTTTTT
  6 537
7 522
h12 F: ACGAGTACACCGACTACGGC
R: TGGGTGGTTGGTGTAAATGA
  7 316
8 224
h13 F: TTTCCCCCTCTATTGATCCC
R: GTGGCCTTGGTATGTCCTTT
x
x
8 010
8 824
h14 F: CCCACCAATCACATGCCTAT
R: TGTAGCCGTTGAGTTGTGGT
x 8 619
9 557
h15 F: TCTCCATCTATTGATGAGGGTCT
R: AATTAGGCTGTGGGTGGTTG
  9 375
10 266
h16 F: GCCATACTAGTCTTTGCCGC
R: TTGAGAATGAGTGTGAGGCG
  11 061
10 919
h17 F: TCACTCTCACTGCCCAAGAA
R: GGAGAATGGGGGATAGGTGT
x 10 703
11 503
h18 F: TATCACTCTCCTACTTACAG
R: AGAAGGTTATAATTCCTACG
x 11 337
12 201
h19 F: AAACAACCCAGCTCTCCCTAA
R: TCGATGATGTGGTCTTTGGA
x
x
11 959
12 934
h20 F: ACATCTGTACCCACGCCTTC
R: AAGGGGTCAGGGTTCATTC
x 12 727
13 694
h21 F: GCATAATTAAACTTTACTTC
R: AGAATATTGAGGCGCCATTG
  13 489
14 425
h22 F: TGAAACTTCGGCTCACTCCT
R: AGCTTTGGGTGCTAATGGTG
x 14 245
15 405
h23 F: TCATTGGACAAGTAGCATCC
R: GAGTGGTTAATAGGGTGATAG
x
x
15 200
16 009
Gg11 F: CCCACACAGTTTATGTAGCTTACCTC x 6612
Gg12 R: GAATATTAGCTTTGGGTGCTGATGGTGG x 8093
Gg18 F: CTATCCCTCAACCCCGATATTACT
R: CTTAACCAACTACAACCCCAGACTC
x
x
11 520
12 109
Gg20 F: CCTTACTTCAACCTCCCTAGCCATTG
R: CGTTAACTACTCCTTCCGCCAACTCC
  12 859
14 353