Skip to main content

Advertisement

Table 5 Details on SNP markers scored by pyrosequencing method

From: Mapping a Quantitative Trait Locus (QTL) conferring pyrethroid resistance in the African malaria vector Anopheles funestus

Markers Forward primer 5'-3' Reverse primer Biotine 5'-3' Product size (bp) Sequencing primer 5'-3' Alleles
Chromosome X      
BU21 TGATGGTGGATAAGCAGGTGTA GAAGTTGCGCTTTACCGTGTC 77 CCGCAATCTGGCTAAT A/T
G17 GATACGCTCGAGATGAAGTACCTT CTGTACATCCTCGTTGATCTTGC 102 ATGAAGTACCTTGAGCG A/G
4P9K1 GGCTAGCGGAACGAAATTGATAC TCGTTCGCCACCATATCCAT 108 GAAAAGATAAGCTACGAAAC A/G
Chromosome 2      
BU76 GGCACCGGTCAAGGATGTA GCCAGGAGGTTACAAACCACAG 111 AGGATGTATCCAGCGTTA A/G
7P6P4 GACTAAGCGATTCAATTGGAGGAT CAACGGTAAGCATGGATACTCTCT 112 ATTCAATTGGAGGATATTT A/G
3P6P3 GAGAATGACGGCCAGGTGA GGGTACTTGCGAAGTGTTTCTGAA 142 CAATGTGATAAACGGTATG C/T
AChE TTGGTTCGTGCGGACATC CGGTTCTGATTCTTTAAGCACAGC 175 AGTATTTTTGGGGACG C/T
3BU82 GCACGGGAACTGGAAATGAT GCATCGGAGCGTTTCCTATA 84 ACTGGAAATGATCGTTTA A/G
6BU40 TTCCAGGCCAATGTCAGCA AACGAAAACAAGGGGGAGAATG 78 CCAGGCCAATGTCAG G/T
CYP6Z1 TGTCTGCACCAGCAGCATAGAAC CGGGATTTCATCCAAATGCTA 121 CTTCCGCATTGTTTC  
BU29 GCACGGAGAAGGTGATCAACTA GAGGTTGGTCGCAATTATTCG 188 CCTCCAGAAGAAGTACGAT A/G
BU901 GGTGAGTTTTTTGGTTGCTTAATG TCAATTTCTAAAATGGCATCAACA 97 GAGTTTTTTGGTTGCTT A/G
1BU62 CGGTAAGTATAATATACGCCCAGT GTTTGAGGAACGCATGAGC 75 TATAATATACGCCCAGTACA C/T
Chromosome 3      
BU66 AAGTTCCAGGATGAAGGTGTGTT GCCTTCGGGATGCCATTAT 129 ATGCGAGCTAGCCAA A/G
BU92 ACGACTTCACCGGAGTCTCT CGCTTCTTCCAGGGACTTATT 87 ACGACTTCACCGGAGTCT C/T
5P9J12 CCAACAAATCAGTTCATCAGC CTTTGGCGCGAAGGTAAA 97 TTGTAAAAGTGCTTAAAATG A/C
2P9J14 TACCGTCTGTTTCCTTGGATAATG ATTTCGGCGAAGAACAAATTTAG 80 GCTTGAAGTGGACCTG G/T
BU021 TTTAGGGGTTCCAATTGACGC ACCCATACCGGAACCAGTACCAC 56 ATTGACGCACTCGCT G/T
1P9J10 TGCGTCTTTCGGTACAGGAT AACGTATGTTCTTACCCACAACCA 141 AATCTTTACGGTTGTATCC A/G