Skip to main content

Advertisement

Table 14 Primers used for amplification of gene-specific DNA probes for slot-blot RNA hybridization.

From: Bioinformatic evaluation of L-arginine catabolic pathways in 24 cyanobacteria and transcriptional analysis of genes encoding enzymes of L-arginine catabolism in the cyanobacterium Synechocystis sp. PCC 6803

Primer Name Amplified product DNA sequence 5'→3' direction
sll1336 sll1336 1686 bps ATGTCGTACTGAGTCGCTTC TGGAGTGCAACATGCTGGAC
sll0902 sll0902 627 bps TCCTTCACCGCGGCCATGTA CGGCAGACAGTGGAGCACAA
slr1476 slr1476 986 bps GGTGGCCAGTTGGACTCGAA ATTCCTGAACAGTGCCTAGC
sll0573 sll0573 491 bps AACGGAAGGCATGATCGGTT AACAGTGAGCGTAGTTGGTG
slr0782 slr0782 1325 bps CCATCCTCGTCCTGTGATTG CCAGTACGAATTGCACCATC
sll1077 speB2 1054 bps CAGCAGGAGGTTGACCAAGG CAGCATGGATATAGGCCGGT
slr1022 argD 1224 bps GTTGTTGAATCCGTCGAAGC TTCTGCTTCCGTCACCACTA
slr0370 gabD 895 bps GCCGAGGAATACTTAGCCGA GGTTAGTTGTCCATGCACTG
sll1683 sll1683 858 bps ACCTCTTCCAAGCTGATCTG AGGCAGTGACATCGACGGTA
slr0662 slr0662 739 bps GTTGGACCATTGACGACAGC CTGTCCAACATATCAGCTCG
slr1312 slr1312 853 bps GCCTCCTGGAGCATTGAAGA CCAGCTTGACCAATTCCACA
slr1469 rnpB 599 bps GCGGCCTATGGCTCTAATCA TTGACAGCATGCCACTGGAC