Skip to main content

Table 1 Non-conserved miRNAs and miRNA candidates identified in Populus.

From: Conservation and divergence of microRNAs in Populus

Families Loci Chrom. Sequences Arm Len VB L miRNA*
ptr-miR7000 1 scaffold_9486 AUACCCGGCCGUCGGGGCAA 3' 20 3 0 yes
ptr-miR7001 1 LG_II UUACCAAUACCUCUCAUGCCAA 3' 22 0 24 no
ptr-miR7002* 1 LG_VIII UCUUUCCAACGCCUCCCAUACC 3' 22 40 73 no
ptr-miR7003 1 scaffold_163 UUCAAUGGCUCGGUCAGGUUA 3' 21 77 154 no
ptr-miR7004 1 scaffold_148 UCGUAAUGCUUCAUUCUCACAA 5' 22 39 110 no
ptr-miR7005 1 LG_VIII UCCACAUUCGGUCAAUGUUCC 3' 21 63 50 no
ptr-miR7006* 1 LG_VIII AGAUGGGAGAGUAUGCAAGAAG 5' 22 0 2 yes
ptr-miR7007 1 LG_XII UUCAUUCCUCUUCCUAAAAUGG 5' 22 48 120 no
ptr-miR7008 1 scaffold_219 UCGCAAGUUGGAGGCCUGGCC 5' 21 21 0 no
ptr-miR7009-1# 5 LG_XII UUCUGAACUCUCUCCCUCAAC 5' 21 0 2 no
ptr-miR7009-2# 5 LG_XII UUCUGAACUCUCUCCCUCAAC 5' 21 0 2 no
ptr-miR7009-3# 5 LG_XII UUCUGAACUCUCUCCCUCAAC 5' 21 0 2 no
ptr-miR7009-4# 5 LG_XV UUCUGAACUCUCUCCCUCAAC 5' 21 0 2 no
ptr-miR7010# 1 LG_XV UAAUCUCCACCAUCUCAGCUU   21 2 0 no
ptr-miR7011 1 scaffold_163 CACAAGCAAUCUAGUUGGCUC 3' 21 0 5 no
ptr-miR7012# 1 scaffold_196 AACGACUCUCGGCAACGGA 5' 19 0 2 no
Ptr-miR7013* 1 Scaffold _129 AUUCCUCUUCCUAAAAUGG 5' 19 1 1 no
ptr-miR7014# 1 LG_VIII CUCCACAUUCGGUCAAUGUUC 3' 21 2 0 no
ptr-miR7016 1 scaffold_228 CCGAUUGAAUGGUCCGGUGAA 5' 21 3 5 no
ptr-miR7017 1 Scafold_131 UUUUGGUAAUGCAAGUGUUGC 3' 21 0 5 no
ptr-miR7018 1 LG_IX UGCAUUUGCACCUGCACCUUA 5' 21 4 0 no
ptr-miR7019 1 LG_X UGCCGACCCCACCCAUGCCAA 3' 21 37 2 no
ptr-miR7020 1 scaffold_853 GAAUGGUCCGGUGAAGUGUU 5' 20 3 0 yes
ptr-miR7021 1 LG_VIII UCUUGCCUACUCCUCCCAUUCC 3' 22 7 10 yes
ptr-miR7022 1 scaffold_456 CGGGGUAUUGUAAGUGGCA 5' 19 3 0 yes
ptr-miR7023 1 LG_V AAUCUCCACCAUCUCAGCUUC 3' 21 2 2 no
ptr-miR7024* 1 scaffold_1029 AUUCAGCCCCAUGUCGCUC 5' 19 2 0 no
ptr-miR7025 1 scaffold_20519 CAAUCCCCGACCUCGUGGC 3' 19 0 3 yes
ptr-miR7026# 2 LG_XIII UCCGAUCAUUCCUCCCUCUCC 3' 21 1 1 no
ptr-miR7027# 2 Scafold_11788 UGCUGCCGAGGCCUGGCCUCC 3' 21 1 1 no
ptr-miR7028# 2 Scafold_20519 GGAGGCCAGGCCUCGGCAGCA 3' 21 1 1 no
ptr-miR7029-1* 3 LG_VII UCUCGGACCAGGCUUCAUUCC 3' 21 32 35 no
ptr-miR7029-2* 3 LG_VIII UCUCGGACCAGGCUUCAUUCC 3' 21 32 35 no
ptr-miR7029-3 3 LG_X UCUCGGACCAGGCUUCAUUCC 3' 21 32 35 no
ptr-miR7030 2 LG_X CACAUUCGGUCAACGUUCGAG 3' 21 10 8 no
ptr-miR7031-1# 4 LG_I UGUUCAUGCUAAUUAAUUAGC 5' 21 0 2 no
ptr-miR7031-2# 4 LG_I UGUUCAUGCUAAUUAAUUAGC 5' 21 0 2 no
ptr-miR7031-3# 4 LG_IX UGUUCAUGCUAAUUAAUUAGC 5' 21 0 2 no
ptr-miR7031-4# 4 LG_X UGUUCAUGCUAAUUAAUUAGC 5' 21 0 2 no
ptr-miR7032* 1 LG_X UUGCCGACCCCACCCAUGCCAA 3' 22 37 66 no
ptr-miR7033-1* 4 LG_IV UGGUUGUGGUUGCUUUUCAAA 3' 21 0 2 no
ptr-miR7033-2* 4 LG_IV UGGUUGUGGUUGCUUUUCAAA 3' 21 0 2 no
ptr-miR7033-3* 4 LG_IV UGGUUGUGGUUGCUUUUCAAA 5' 21 0 2 no
ptr-miR7033-4* 4 LG_VIII UGGUUGUGGUUGCUUUUCAAA 3' 21 0 2 no
ptr-miR7034# 1 LG_XII CGAGCCGAAUCAAUAUCACUC 3' 21 0 2 no
ptr-miR7036 1 LG_XIV CUCUCCCUCAAGGCUUCCAA 5' 20 3 5 no
ptr-miR7037 1 scaffold_196 UAAACGACUCUCGGCAACGGA 5' 21 4 5 no
ptr-miR7038# 1 LG_I UGACCUUUCUUGGUGUUGUUAG 3' 22 2 0 no
ptr-miR7039 1 scaffold_163 UCAAUGGCUCGGUCAGGUUA 3' 20 3 7 no
ptr-miR7040-1# 2 LG_XIX UUUGAUCGAUGAGGGAAUAAU 3' 21 2 0 no
ptr-miR7040-2# 2 LG_XIX UUUGAUCGAUGAGGGAAUAAU 3' 21 2 0 no
ptr-miR7041# 1 LG_XIX UUUGUGGAACUCGAACUGGU 5' 20 2 0 no
ptr-miR7042# 1 scaffold_163 CAGAUCAUGCCAUGACAGAAG 5' 21 2 0 no
ptr-miR7043# 1 scaffold_245 UUGGUUGCGCAUGAACCUGA 5' 20 2 0 no
ptr-miR7044 2 scaffold_163 UGACAGAAGAGUUAAAUGUUGA 5' 22 2 2 no
ptr-miR7046-1* 2 LG_VI CCACAGCUUUCUUGAACUGCA 3' 21 2 1 no
ptr-miR7046-2* 2 LG_XVIII CCACAGCUUUCUUGAACUGCA 3' 21 2 1 no
ptr-miR7047 1 LG_XIV UUGACGAAAUGUGACGACUAC 3' 21 7 0 no
  1. The length (len) of each miRNA, the number of loci (loci), the number of times a sequence was sampled in leaf (L) and vegetative buds (VB), and whether or not a miRNA star (miRNA*) was observed are indicated. (*) indicate miRNAs for which the expression was confirmed by northern hybridization. (#) indicate miRNA candidates.