Skip to main content

Table 2

From: Intercenter reliability and validity of the rhesus macaque GeneChip

Gene  
SNAP25 Forward primer
  TGCTGTGAAACAGTGTGGATGTAAA
  Reverse primer
  GCAACAAAGAATTGTACTGATAACAAACCA
  Probe
  ACTAACCACCATTTCCC
TKTL1 Forward primer
  GAATTGTAGATTGCAGTAGCCTAGGT
  Reverse primer
  GGAACAGCGGTAGGTGTCATG
  Probe
  CCACAGCACAATAACA
PRSS2 Forward primer
  GCTGAGTGTGAAGCCTCCTA
  Reverse primer
  AGGAAGCCCACACAGAACATG
  Probe
  TTGCTGGTAATCTTCC
CD8A Forward primer
  GGCAGACCTGACTCTCTTAAGGA
  Reverse primer
  CAGGCATTGCTTGTACCATACTGTA
  Probe
  CTGCTGTCCCAAACAC
GREM1 Forward primer
  TGCAGATTTGGCTCAAGTAAAGAGA
  Reverse primer
  GCTGTGCTTTTAGGGTAGTTATGCT
  Probe
  CTCCACTGGAATAACC