Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Gene-specific primers used for quantitative RT-PCR

From: Gene array and real time PCR analysis of the adrenal sensitivity to adrenocorticotropic hormone in pig

Gene symbol Forward Primer Reverse Primer accession no.
Dab2 CCCGTGATGTGACAGACAACC ACTAATGGCTCTGCCTGTTGC BX918681
A2m ACGTGAGCCGAACAGAGGTC GCGATGGCAAACTCAGCTG BX674240
Anpep CTCATTCGGAAGCAAGACGC CCACCGCCATAGTCCTGAAA BX665286
Fxc1 TCCTTCCAGGAGGCCTGTC GCTGTACCAGGGCAGGCAT BX674767
Rnf2 CACTGTGTTAAATGGCTCTTTTTCTT TGTGCTCCTTTGTGGGTGC BX673517
Gadd45b GCTGATGAATGTGGACCCTGA CCTGACACCCGCACGATATC BX671980
Eif1b GTTTCTCTTGGAGGTTGGCATT TCACGAGGCAGCCAAACTG BX926052
Crem AACACGCAAACGAGAGCTGAG GCACAGCCACACGGTTTTC BX670994
Tkt GGACAGGAAGCTCATTCTCGA AGCAGCCACTGCCTCACCTA BX925610
Star GAAGAGCTTGTGGAGCGCAT AGCCAACTCATGGGTGATGAC U53020
Scarb1 TGTGGTTTGCAGAGAGCGG ATGAACAGCAGGACGCAGC NM_213967
Cyp21 TGCTTCACCACCCTGAGATTC GCCCAGCTCGCGATCTAAC BX916139
Cyp11a1 AGACACTGAGACTCCACCCCA GACGGCCACTTGTACCAATGT BX674077
Ldlr GCCTCACAGGCTCGGACATA ACACCAGTTCACCCCTCTCG BX673438
Sqle TGGTCCAGTTGCGCTGATT GGGCTCCGATTTAAAGCAAAA BX920102
Bzrp GGCACACTCTACTCGGCCAT ACAGCCTCCTCCGAGAAGCT BX925849
Ckb TTCACCCGCTTCTGCAATG AGGTCAGGATGTAGCCCAGGT BX920566
Hsd3b1 TTCCGCCCTCTCTGAGGTACT GGTCACGAAGTGGCGATTG BX919321
Bmal1 TCCTAGCCAACGTCCTGGAA TCTTTGGGCCACCTTCTCC EF216896
Cry1 TGAACCACGCTGAGGCAAG GGATTAGATGGCACTGACGCA BQ600826
Per2 GACGTGCCGGAATGTGTTTAC GCTCCCGGTTTCTGTGACTC CF789448
Mc2r ACCATGTCCCCGCAGTGAT GTGATGGCCCCTTTCATGTT AF450083
Cyp11b CCCGTGGGTATCTTCTTGGA GGTTTCGACCCAGGGAGTAGA D38590
  1. Gene-specific primers were designed based on sequences provided under the accession numbers listed in the National Center for Biotechnology Information (NCBI) database.