Skip to main content

Table 2 Primer list and amplicon lengths for 17 validated SFP-containing amplicons.

From: Detection and validation of single feature polymorphisms in cowpea (Vigna unguiculata L. Walp) using a soybean genome array

Affymetix probe set Primer Name Forward primer (5' – 3') Reverse Primer (5 – 3') Predicted* amplicon size (bp) Observed# amplicon size (bp)
Gma.7528.1.S1_s_at GS01 GTACCTTCCGGTGGATTCAA TGGAATGATCACTTGGCAGA 435 439
GmaAffx.93250.1.S1_s_at GS02 AATCCGTGTGCCAGGAATAG ACCCAATCAGACCAATGGAG 416 420
Gma.1164.2.S1_at GS03 GTCTTTTTGGCCTTGCATGT TCTCAGCTTCTCCGTCCATT 422 424
Gma.1555.1.S1_a_at GS04 AACAACAGAGTGAGCCAGCA ACCAGGGTACCTCCCTTGAC 400 402
Gma.1863.1.S1_at GS07 GCAGGAGTGCGTTTACCCTA TGCTTTCACACCGCAAATTA 417 424
GmaAffx.86591.1.S1_at GS08 TGGGAGCTGTGTCAACAGAA GGCCTCTCAAACTGAACGTC 431 433
Gma.4431.1.S1_at GS12 TAGCAGCCAGCCTGTGTATG CGAAGGGTCCTAAACAACCA 447 449
Gma.8053.1.S1_at GS16 ATCTGAGGCAGCAGCAAAAG TGCCATGGCCACTTTAGATT 402 407
GmaAffx.62051.1.S1_at GS21 GAAGCGTTGCATGCTTATCC CATTCCAGTCACACCACCAG 429 432
GmaAffx.58155.1.S1_at GS22 GTTAAACGCACCGATGGACT ACACACTCGCCAAACAATGA 404 406
Gma.5674.1.S1_a_at GS23 GCGGTGTTTCTTTCATGGTT TCCCTCGTATATTCGGCATT 429 433
Gma.1449.1.S1_s_at GS24 GCCTTTCTTCAGTGGATTGG TGATTCACAACCCCATTTGA 442 444
Gma.13293.1.S1_at GS27 TCTGCATTAAGCCACTGCAC AATAGCAGCACCACGATTCC 442 441
GmaAffx.14067.1.S1_at GS29 GGCATCCCTCTCAAGAATGT GCAACAAAAATGGGGTGAGA 424 427
GmaAffx.69322.1.S1_at GS31 AGTCTTATGTTGGCACAAAAACA GCCAACTCTACCCACCAAGA 433 433
GmaAffx.28120.1.s1_at GS36 CATCAGACACAGACGGCACT TCACACCAATCTCCCAAACA 414 413
GmaAffx.70836.1.S1_at GS37 CGTTCCAGTGGACATTATGC AGATTCTTTTTGCCCAAGCA 441 431
  1. *Predicted size indicates the PCR product size anticipated by the primer3 program.
  2. #Observed size indicates size of amplicon sequences after assembling the bidirectional sequence reads.