Skip to main content

Table 2 Primers used to perform the genomic DNA amplification. Additional couples of primers (e.g. 1N, 1NN and 2-3N) were used for each amplicon as it was not possible to amplify DNA from all the primates using a single set (e.g. 1 and 2–3).

From: Evolution of the hepcidin gene in primates

EXON FORWARD PRIMER REVERSE PRIMER
1 5' tctctcccgccttttcgg 3' 5' tgaggcctggctctccc 3'
1N 5' gccttttcggcgccac 3' 5' agacgtcctgagctctgctca 3'
1NN 5' ccccataaaagcgactgtcac 3' 5' ctcccatccctgctgcc 3'
2–3 5' gtttaaaccacttggagaggagca 3' 5' acactcggcagagagaaaggac 3'
2-3N 5' gaggtccactgggcccc 3' 5' acatgacccaccaagcactg 3'