Skip to main content

Table 1 List of gene specific primer sets used for expression pattern analysis

From: Major histocompatibility complex (Mhc) class Ib gene duplications, organization and expression patterns in mouse strain C57BL/6

Gene Primer set   Size (bp)
  Forward Reverse  
H2-K1 GGGAGCCCCGGTACATGGAA GGTGACTTTATCTTCAGGTCTGCT 548
H2-D1 TCGGCTATGTGGACAACAAGG GGCCATAGCTCCAAGGACAC 818
H2-Q1 CTGCGGTATTTCGAGACCTCG GGTATCTGTGGAGCCACATCAG 502/686
H2-Q2 ACACACAGGTCTCCAAGGAA TGGATCTTGAGCGTAGTCTCTTA 785
H2-Q4 CTTGCTGAGTTATTTCTACACCT ACCGTCAGATCTGTGGTGACAT 583
H2-Q5 GGGAGCCCCGGTTCATCATC CAGGGTGACAGCATCATAAGATA 539
H2-Q6 GTATTTCCACACTGCTGTGTCCT AAGGACAACCAGAATAGCTACGT 871
H2-Q7 CGGGCCAACACTCGCTGCAA GTATCTGCGGAGCGACTGCAT 515
H2-Q10 CACACTCCATGAGGTATTTCGAA CAGATCAGCAATGTGTGACATGATA 590/866
H2-T24 ATGCACAGTACTTCACTCATG CCCCTAGCATATACTCCTGTCG 736/839
H2-T23 AGTATTGGGAGCGGGAGACTT AGCACCTCAGGGTGACTTCAT 438
H2-T22 CTGGAGCAGGAGGAAGCAGATA CAAATGATGAACAAAATGAAAACCA 698
H2-T15 ACCGCCCTGGCCCCGACCCAA CATCCGTGCATATCCTGGATT 332
H2-T13 GCCCTGACTATGATCGAGACT CACCTCAGGGTGACATCACCTG 635
H2-T11 CGGTATTTCCACACCGTCGTA TAGAGATATGCGAGGCTAAGTTG 415/628
H2-T10 CCCTTTGGGTTCACACTCGCTT CCTGGTCTCCACAAACTCCACTTCT 661
H2-T9 ACCGCCCTGGCCCCGACCCGA CATCCGTGCATATCCTGGATA 332
H2-T7 CTTCACACGTTCCAGCTGTTGTT AGGCCTGGTCTCCACAAGCTCT 432
H2-T5 GGTGGTGTTGCAGAGACGCT CTGCTCTTCAACACAAAAGG 482
H2-T3 TTCAACAGCTCAGGGGAGACTG AAGCTCCGTGTCCTGAATCAAT 585
H2-M3 CAGCGCTGTGATAGCATTGA ACAACAATAGTGATCACACCT 806
H2-M2 GAGGAGACCCACTACATGACTGTT GAAAATGAAAGACTGAGGAGGTCTAC 798
b2 m* ATGGCTCGCTCGGTGACCCTG ATTGCTCAGCTATCTAGGATA 546
GAPDH* TGAAGGTCGGTGTGAACGGATTTG GGCCTTCTCCATGGTGGTGAAGAC 314
  1. *Sequences of these primers were obtained from a previous report [25].