Skip to main content

Table 4 MDV encoded microRNAs

From: Deep Sequencing of Chicken microRNAs

Name and Sequence (5' -> 3') Length # Reads MDV/IRL Position
mdv1-miR-M1: TGCTTGTTCACTGTGCGGCA1 20 304 136873
mdv1-miR-M2: GTTGTATTCTGCCCGGTAGTCCG1 23 191 134231
mdv1-miR-M2*: CGGACTGCCGCAGAATAGCTT1 21 16 134270
mdv1-miR-M3: ATGAAAATGTGAAACCTCTCCCGC1 24 13 134080
mdv1-miR-M4: TTAATGCTGTATCGGAACCCTTC1 23 206 134368
mdv1-miR-M4*: AATGGTTCTGACAGCATGACC1 21 6 134405
mdv1-miR-M5: TGTGTATCGTGGTCGTCTACTGT1 23 62 133647
mdv1-miR-M5*CGTATGCGATCACATTGACACG 22 12 133609
mdv1-miR-M6: GAGATCCCTGCGAAATGACAGT1 22 87 142370
mdv1-miR-M6*: TGTTGTTCCGTAGTGTTCTCG 21 39 142335
mdv1-miR-M7: TCGAGATCTCTACGAGATTACAG1 23 15 142547
mdv1-miR-M8: GTGACCTCTACGGAACAATAGT1 22 50 142258
mdv1-miR-M8* TATTGTTCTGTGGTTGGTTTCG 23 11 142216
mdv1-miR-M9: TGTTGATCCGTAGATAGGCGATGGC 25 5 96961
mdv1-miR-M10: GCGTTGTCTCGTAGAGGTCCAG1 22 4 142627
mdv1-miR-M10*: TCGAAATCTCTACGAGATAACAGTT 25 2 142669
mdv1-miR-M11: TTGCATAATACGGAGGGTTCTG 22 3 133925
mdv1-miR-M12: TGCTACAGTCGTGAGCAGATCAA 23 10 136581