Skip to main content

Table 4 Primers used for probes, sequencing and gene expression.

From: Multiple expressed MHC class II loci in salmonids; details of one non-classical region in Atlantic salmon (Salmo salar)

Primer Sequence (5'-3') Position Comments
oOV4F GCGCCATACTGGACAAGACAG Exon 2 cDNA amplification Sasa-DAB
oOV6R CTGCTGCAGATTCAGCAACAT 3' UTR cDNA amplification Sasa-DAB
DAB40F ATGTCGATGTCTATCTTCTG Exon 1 cDNA amplification Sasa-DAB
DAB489R GTACCAGTCCCCGTTAGCCAG Exon 3 cDNA amplification Sasa-DAB
DAA66F TGCTGGCAGGTGTATGCAGAA Exon 1 cDNA amplification Sasa-DAA
DAA660R GAATGTTCCGGCAGCCACTCC Exon 4 cDNA amplification Sasa-DAA
DBA19F TCACTGGAGCCGTTTGCACTT Exon 1 cDNA/gDNA amplification Sasa-DBA
DBA51F CATCATGAAATTCACTTTATC Exon 2 cDNA/gDNA amplification Sasa-DBA
DBA304R CTTTGATTTTTGGTATTTTCG Exon 2 cDNA/gDNA amplification Sasa-DBA
DBA660R CCCCAGCAGCCCAAGAGTGAG Exon 4 cDNA/gDNA amplification Sasa-DBA
DBB98F CTCTGAGACTTGATTATGTAT Exon 1 cDNA/gDNA amplification Sasa-DBB
DBB177F TTGATTCCTCAGATGAAGATT Exon 2 cDNA/gDNA amplification Sasa-DBB
DBB441R CCATAAACATCTCTGTTGCGT Exon 2 cDNA/gDNA amplification Sasa-DBB
DBB825R CAGTAGATTTCGCCCAGTAGA Exon 4 cDNA/gDNA amplification Sasa-DBB
DA847F GATGGCAAAGAGGAAAGTGAG 3' UTR FAM labeled minisatellite primer for Sasa-DAA
DA1054R TTGTTATGCTCTACCTCTGAA 3' UTR Minisatellite primer for Sasa-DAA
Sp6 ATTTAGGTGACACTATA pTARBAC2.1 End sequencing BAC vector Sp6 end
T7 TAATACGACTCACTATAGGG pTARBAC2.1 End sequencing BAC vector T7 end
M13F GTTTTCCCAGTCACGAC pUC19 DNA plasmid sequencing primer
M13R CAGGAAACAGCTATGAC pUC19 DNA plasmid sequencing primer
EF1A_F CACCACCGGCCATCTGATCTACAA Acc. No. AF321836 Real-time PCR Elongation factor 1-alpha
EF1A_R TCAGCAGCCTCCTTCTCGAACTTC Acc. No. AF321836 Real-time PCR Elongation factor 1-alpha
DAB566F ATGGTGGAGCACATCAGCC Exon 3 Real-time PCR Sasa-DAB
DAB620R CTCAGCCTCAGGCAGGGAC Exon 4 Real-time PCR Sasa-DAB
DBB418F GCCATATGCTAATCGGATCTAC Exon 3 Real-time PCR Sasa-DBB
DBB500R ACACACAAGGCTGGAGTCACT Exon 4 Real-time PCR Sasa-DBB
DBA538F GCATCGCATGGGGCAAACAG Exon 3 Real-time PCR Sasa-DBA
DBA641R ATTCACAAAGCAGATGAGGGTG Exon 4 Real-time PCR Sasa-DBA
DCA277F GATTGTGTCGGGATGCCTTG Exon 2 Real-time PCR Sasa-DCA
DCA357R CTCCTCAGCCCTGGGGTAGAT Exon 3 Real-time PCR Sasa-DCA
DDA225F AGTTGCAGAGAGCCGAAGAGC Exon 2 Real-time PCR Sasa-DDA
DDA317R TTCACTTCATCCTTGGCATACA Exon 3 Real-time PCR Sasa-DDA