Skip to main content

Table 1 Oligonucleotide sequences used in quantitative real-time RT-PCR analysis.

From: In vivo gene expression profiling of human intestinal epithelial cells: analysis by laser microdissection of formalin fixed tissues

PCR Primer Pairs
  Sense Antisense
HD5 5'GCCATCCTTGCTGCCATT 3' 5'GCTTCTGGGTTGTAGCCTCATC 3'
REG3A 5'CGCTGTCCCAAAGGCTCCAAG 3' 5'GCACAGACACCAGGTTTCCAGAGG 3'
RELMB 5'CAGTGTTCCTTAGACTCCGTTATGG 3' 5'ACGGTCTGCCTTGGCTTTTG 3'
EPS8L2 5'CGGCTGGGCAAGAAGATGCG 3' 5'GTGCTGGAAGGGGATGGGCG 3'
MUC3B 5' TGACGCTCAGCAAAACCGATAAC 3' 5' AACAGGCTTCAGGACCAAGACAGC 3'
PDXP 5' ACTCATCAATGTTGGGTCCTGTGG 3' 5' AGGGTCATCGTCACTTAGGCTTCC 3'
APOA4 5' AACTCACCCAGCAACTCAATGCC 3' 5' CTCCTTCCCAATCTCCTCCTTCAG 3'
SEMA3F 5' GCTGGTCAGAGACGGCAGAAAAC 3' 5' TGCTCCCTCCCTTTGTCCTGTAG 3'
EPHB3 5' AACGATGGGCAGTTCACGGTC 3' 5' GCTGTTGACAAGGATGTTGCGAG 3'
ALDOB 5' TGCTATCAACCTTTGCCCTCTACC 3' 5' CCCCAGAAGAACCCGTGTGAAC 3'
BActin 5' TGATGGTGGGCATGGGTCAG 3' 5' CGTGCTCGATGGGGTACTTCAG 3'