Identification and characteristics of microRNAs from Bombyx mori

He, Ping-an; Nie, Zuoming; Chen, Jianqing; Chen, Jian; Lv, Zhengbing; Sheng, Qing; Zhou, Songping; Gao, Xiaolian; Kong, Lingyin; Wu, Xiangfu; Jin, Yongfeng; Zhang, Yaozhou

doi:10.1186/1471-2164-9-248

BMC Genomics

Table 1 Information for all 46 predicted B. mori miRNA sequences

From: Identification and characteristics of microRNAs from Bombyx mori

miRNAs	Sequence	Size (nts)	miRBase/first prediction	Predicted in this study	Northern blot identification	Source	Position	Number of mismatched bp with Drosophila orthologs	Number of potential targets
bmo-let-7a	GAGGUAGUAGGUUGUAUAGU	20	yes	yes	yes	BAAB01030021	359–379	0	10
bmo-let-7a*	ACUGUAUAGCCUGCUAACUUU	21	no	no	no	BAAB01030021	404–424		9
bmo-miR-1	UGGAAUGUAAAGAAGUAUGGAG	22	yes	yes	yes	BAAB01105211	2140–2161	0	1
bmo-miR-1*	UUCCGUGCUUCCUUACUUCCCA	22	no	no	no	BAAB01105211	2098–2124		12
bmo-miR-2a-1	UAUCACAGCCAGCUUUGAUGAGC	23	no	yes	yes	BAAB01090954	2892–2870	0	22
bmo-miR-2a-1*	GGCAUCAAAGUCGGUUUGUCAUA	23	no	no	no	BAAB01090954	2929–2907		15
bmo-miR-2a-2	UAUCACAGCCAGCUUUGAUGAGC	23	no	no	yes	BAAB01090954	2476–2454	0	22
bmo-miR-2b	UAUCACAGCCAGCUUUGUUGAGU	22	no	yes	yes	BAAB01090954	2355–2334	2	38
bmo-miR-7	GUAUGGAAGACUAGUGAUUUUGUUGU	26	yes	yes	no	BAAB01189120	2066–2091	0	6
bmo-miR-8	UAAUACUGUCAGGUAAAGAUGUC	23	yes	yes	yes	BAAB01175925	75–53	0	5
bmo-miR-8*	GCAUCUUACCGGGCAGCAUUA	21	no	no	yes	BAAB01175925	115–95		16
bmo-miR-9	UCUUUGGUUAUCUAGCUGUAUGA	22	yes	yes	yes	BAAB01140220	35–56	0	10
bmo-miR-9*	UCAUAAAGCUAGGUUACCGGAG	22	no	no	yes	BAAB01140220	69–90		6
bmo-miR-10	ACCCUGUAGAUCCGAAUUUGU	21	yes	yes	no	BAAB01187436	558–538	1	3
bmo-miR-10*	ACAAAUUCGGUUCUAGAGAGGU	22	no	no	no	BAAB01187436	524–503		6
bmo-miR-13a*	CCUGUCAAAGCGGCGGUGAAA	21	no	no	no	BAAB01090954	2777–2757		35
bmo-miR-13b	UAUCACAGCCAUUUUUGACGAGU	23	no	yes	yes	BAAB01090954	2615–2593	1	6
bmo-miR-14	UCAGUCUUUUUCUCUCUCCUA	21	yes	no	yes	BAAB01082886	457–437	0	8
bmo-miR-31	GGCAAGAAGUCGGCAUAGCUG	21	yes	yes	yes	BAAB01205265	3219–3239	3	14
bmo-miR-34	GGCAGUGUGGUUAGCUGGUUGUGUA	25	yes	yes	no	BAAB01147222	1437–1471	1	197
bmo-miR-46	UGUCAUGGAGUUGCUCUCUUUA	22	no	no	no	BAAB01025185	703–722	2	7
bmo-miR-46*	UGAAGAGAGCUAUCCGUCGACA	22	no	no	no	BAAB01025185	664–685		10
bmo-miR-71	UGAAAGACAUGGGUAGUGA	19	yes	no	no	BAAB01131802	2236–2218	0	6
bmo-miR-79	UUCAUAAAGCUAGAUUACCAAAGCAU	26	no	yes	no	BAAB01113362	535–510	1	2
bmo-miR-87	UGAGCAAACUUUCAGGUGUGU	21	no	yes	no	BAAB01164262	758–778	2	4
bmo-miR-133	UUGGUCCCCUUCAACCAGCUGU	22	no	yes	no	BAAB01208622	2993–3014	0	11
bmo-miR-184	ACUGGACGGAGAACUGAUAAGGGC	24	no	yes	no	BAAB01083504	1684–1661	0	7
bmo-miR-210	UUGUGCGUGUGACAGCGGCU	20	no	yes	no	BAAB01031372	2309–2290	0	95
bmo-miR-263a	AAUGGCACUGGAAGAAUUCAC	21	yes	yes	yes	BAAB01106279	2833–2853	2	4
bmo-miR-263b	CUUGGCACUGGGAGAAUUCACAG	23	yes	yes	no	BAAB01015424	804–782	0	19
bmo-miR-263b*	CGUGAAUUUCCCGAUGCCUUA	21	no	no	no	BAAB01015424	764–744		8
bmo-miR-275	AGUCAGGUACCUGAAGUAGCGCGCG	25	yes	yes	no	BAAB01118959	480–456	0	41
bmo-miR-276a	UAGGAACUUCAUACCGUGCUCU	22	no	yes	yes	BAAB01199848	358–337	0	1
bmo-miR-276a*	(C)AGCGAGGUAUAGAGUUCCUA(CG)	22	yes	no	no	BAAB01199848	395–374		6
bmo-miR-277	UAAAUGCACUAUCUGGUACGACA	23	yes	no	yes	BAAB01014298	12099–12121	0	4
bmo-miR-279	UGACUAGAUCCACACUCAU	19	yes	yes	yes	BAAB01102170	714–732	3	0
bmo-miR-279*	AUGAGUGGAGGUUUAGUGCA	20	no	no	no	BAAB01102170	679–698		37
bmo-miR-281a	ACUGUCAUGGAGUUGCUCUCUU	22	no	yes	yes	BAAB01025185	701–722	3	18
bmo-miR-281a*	AAGAGAGCUAUCCGUCGACAGU	22	no	no	yes	BAAB01025185	666–687	0	10
bmo-miR-282	UAGCCUCUCCUUGGCUUUGUCUG	23	yes	yes	no	BAAB01005896	688–710	4	32
bmo-miR-283	UAAAUAUCAGCUGGUAAUUCUGGG	24	yes	yes	no	BAAB01105947	466–443	0	4
bmo-miR-305	UGUACUUCAUCAGGUGCUCUGG	22	Yes	yes	no	BAAB01118959	386–365	0	16
bmo-miR-305*	CAGGCGCUUGUUGGAGUACACU	22	no	no	no	BAAB01118959	352–331		66
bmo-miR-307	CAUCACAACCUCCUUGAGUGAGCGAU	26	yes	yes	no	BAAB01178566	1478–1503	0	19
bmo-miR-317	AGUGAACACAGCUGGUGGUAUC	22	no	yes	no	BAAB01140584	492–471	1	21
bmo-bantam	UGAGAUCAUUGUGAAAGCUAAUU	23	no	no	yes	BAAB01089624	1355–1373	1	1
bmo-miR-100-like	AACCCGUAGAUCCGAACUUGUG	22	no	no	yes	BAAB01129141	1755–1776	0	5

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com