Skip to main content

Table 3 Primer sequences for qRT-PCR validation.

From: Discovery of genes implicated in whirling disease infection and resistance in rainbow trout using genome-wide expression profiling

Gene Accession Forward primer Reverse primer
Interferon regulating factor 1 CA063565 TCGTCCGGGAATATACTGCT CGTTGCCAGAACATCACATC
Ubiquitin-like protein 1 CB499972 AAAGCCAATATCAGCCATGC ACCTGAAGCCCTTAACTTA
Metallothionein-B CB507722 ACACACACAGCCTGAAGCAC TGAATAAAGAAGCGCGATCA
β-actin AF157414 GCCCTCTTCCAGCCCTCCTTCCT TGCCGGGGTACATGGTGGTTCCT